depot/pkgs/by-name/bo/bowtie2/package.nix
Luke Granger-Brown 4a76db2401 Squashed 'third_party/nixpkgs/' changes from 76612b17c0ce..dc460ec76cbf
dc460ec76cbf Remove obsolete libXrandr inputs from programs using winit (#354847)
f1b26f503aac nitrokey-udev-rules: init at 1.0.0 (#352481)
a4761c00db07 smartcat: 1.7.1 -> 2.1.0 (#354016)
60533322e317 protonvpn-gui: 4.6.0 -> 4.7.3 (#354170)
ab599469897c yosys: 0.46 -> 0.47 (#354226)
736b36d5719f niri: 0.1.9 -> 0.1.10 (#355047)
547ac36fb30e spotify-player: 0.20.0 -> 0.20.1 (#354593)
6c3d0282c839 netbird: 0.30.2 -> 0.31.0 (#354756)
fcfcc8e0f43d proton-ge-bin: GE-Proton9-18 -> GE-Proton9-20 (#354849)
2e3b9c403874 miriway: 24.09 -> 24.10.1 (#353939)
c598a008a26b gfn-electron: init at 2.1.2 (#353887)
fcf7e79c02e9 python312Packages.anthropic: 0.35.0 -> 0.39.0 (#354808)
9e9dc89f01d1 python312Packages.githubkit: 0.11.11 -> 0.11.14 (#354763)
3d7216f0da32 nzportable: init at 2.0.0-indev+20241012190425 (#312424)
1d4a687f62fc python312Packages.scikit-rf: 1.3.0 -> 1.4.1 (#354453)
566bf556282a typos: 1.26.0 -> 1.27.3 (#354980)
9a7641474d1c python312Packages.google-generativeai: 0.8.2 -> 0.8.3 (#354919)
76e387b03039 python312Packages.{localstack-ext,localstack}: fix build and refactor (#354962)
d056782c98a1 python3Packages.globus-sdk: fix test (#354988)
1ce8fcbc506b hyprlandPlugins: update plugins (#355037)
43c84259fd1b python312Packages.tensorflow-probability: 0.24.0 -> 0.25.0 (#355007)
8c79491aea4c obsidian: remove white background from icons (#354945)
b3057fce636d niri: add patch for scrolling without mouse config
97ca8ccb1551 nixos/roundcube: add example for `database.passwordFile` (#348166)
f0b14e4fb4be niri: install dinit service files
172f0cee3628 python312Packages.wordcloud: 1.9.3 -> 1.9.4 (#355027)
cf81310c69b9 prettypst: unstable-2023-12-06 -> unstable-2024-10-20 (#354972)
4d9d042055b6 cvise: 2.10.0 -> 2.11.0 (#354970)
7514add1990f python312Packages.google-ai-generativelanguage: 0.6.10 -> 0.6.12 (#354917)
66eab41e34dd python312Packages.tencentcloud-sdk-python: 3.0.1262 -> 3.0.1263 (#354909)
2ec42a007584 python312Packages.pyswitchbot: add pytest-asyncio (#354911)
fa1b67747b3b  ggshield: 1.32.2 -> 1.33.0  (#354912)
918a840f93bf python312Packages.reolink-aio: 0.10.4 -> 0.11.0b1 (#354910)
f5c93dd4908f python312Packages.google-cloud-bigquery-logging: 1.4.5 -> 1.5.0 (#354918)
9e48e1749f0a python312Packages.soco: 0.30.5 -> 0.30.6 (#354943)
12569c191eb1 completely: 0.5.2 -> 0.6.3, move to by-name (#354974)
2049461e5435 python3Packages.protobuf4: disable tests that fail on 32bit (#354992)
3f42f0b61e6c linux-firmware: 20241017 -> 20241110 (#355130)
4c3539c70b79 linux-firmware: 20241017 -> 20241110
7ff8d0f160be vaultwarden: 1.32.3 -> 1.32.4 (#355129)
7d4246729b44 vaultwarden: 1.32.3 -> 1.32.4
e635cf8d9fb5 netsurf.browser: fix darwin builds (#355038)
8feb5e84c9e9 libskk: fix parse error (#355005)
b71ccf87b23c gnuplot: fix build with `withTeXLive = true` (#352768)
96e1c83061ff pyamlboot.tests: fix the eval (#352825)
87e380382121 nix-unit: 2.24.0 -> 2.24.1 (#355104)
f257cb5e5ee1 kubectl-graph: init at 0.7.0, add maintainer rksm (#348297)
b3dc0d06fdad buck2: Add shell completions (#354758)
9d2100929da8 rapidfuzz-cpp: 3.0.5 -> 3.1.1 (#351052)
3f334c14975e scopehal-apps: darwin support (#354815)
f03a58a929b4 roboto-flex: init at 3.200 (#353851)
5c1e2db52711 libnvme: 1.10 -> 1.11 (#352703)
f94a3e0cd12e nix-unit: 2.24.0 -> 2.24.1
628110078b5c libdatachannel: 0.21.2 -> 0.22.2 (#350821)
db0b0737bfdc obs-studio-plugins.obs-hyperion: patch stateChanged deprecation (#349326)
b3c4badad7e2 roboto-flex: init at 3.200
5812399690b8 gcsfuse: 2.4.0 -> 2.5.1 (#351360)
771d3917283d azure-storage-azcopy: 10.26.0 -> 10.27.0 (#352775)
a8489059c4eb signal-desktop: remove stdenv.cc.cc from runtimeDeps (#354924)
f475d7505046 python3Packages.pywebview: build fix for tests (#353833)
5b27ef3c5495 pantheon.elementary-onboarding: 8.0.1 -> 8.0.2 (#354896)
a0c28de3e7d7 phonemizer: fix build (#354946)
802cb21f2a2a python3Packages.us: switch to pyproject (#354950)
99ad7da9e313 nixosTests.frr: fix node.router.config warning (#354710)
a44589e11da3 python312Packages.phonopy: 2.28.0 -> 2.29.1, fix build (#354523)
cb9613de4c67 python312Packages.tskit: relax numpy build-time constraint, unbreak (#354512)
bc1a933e128d evcc: 0.131.4 -> 0.131.5 (#355083)
20ee59317101 nixos/frigate: Set SyslogIdentifier for better log entries (#355088)
503b5b4c8cba rime-zhwiki: init at 20240909 (#354931)
dac96aac49af nixos/frigate: Set SyslogIdentifier for better log entries
871087c18d34 nixos/acme: do not limit credentials functionality to DNS/S3 config (#348344)
8c164faef4d4 nixos/nextcloud-notify_push: fix defaultText rendering (#352479)
8209b0d9b9b0 netclient: 0.25.0 -> 0.26.0 (#354525)
96115f656695 python312Packages.pytest-flake8: 1.2.2 -> 1.3.0 (#354743)
6b5935539883 texlivePackages.xetex: force XeTeX to use fontconfig on Darwin (#354963)
32e064f48c2b evcc: 0.131.4 -> 0.131.5
1593115346ba piano-rs: init at 0.2.0 (#336405)
a67e90c4928a wibo: 0.4.2 -> 0.6.14 (#291723)
5b74eb9b909e scopehal-apps: darwin support
71734a22978f pypy3Packages.home-assistant-chip-clusters: fix the eval (#355051)
ab58dcfaf4c5 maintainers/README: add guidelines for committers (#351744)
95855a90f9d0 aquamarine: 0.4.3 -> 0.4.4 (#355030)
34ed0c9cc1bb scarab: Apply scaling factor in Wayland (#348427)
ae725bafb39b python312Packages.debugpy: 1.8.7 -> 1.8.8 (#354925)
eba346ebfead teamspeak3: modernise (#354161)
673033d742b2 yubioath-flutter: 7.1.0 -> 7.1.1 (#352448)
8f0c9853d549 pypy3Packages.home-assistant-chip-clusters: fix the eval
e80622178221 niri: 0.1.9 -> 0.1.10
8aed22ecd71e quarto: 1.6.30 -> 1.6.33 and apply patch (#354672)
0198cfb7673a hyprlandPlugins.hyprsplit: 0.44.1 -> 0.45.0
f3f9fcf93c8d hyprlandPlugins.hyprspace: 0-unstable-2024-09-16 -> 0-unstable-2024-11-02
cbc60c36101f hyprlandPlugins.hyprscroller: 0-unstable-2024-10-10 -> 0-unstable-2024-11-09
d9e2143b3e56 hyprlandPlugins.hyprgrass: 0.8.2 -> 0.8.2-unstable-2024-10-30
9739ac3afe95 hyprlandPlugins.hyprfocus: 0-unstable-2024-05-30 -> 0-unstable-2024-10-09
7804dcce6c5b hyprlandPlugins.hypr-dynamic-cursors: 0-unstable-2024-10-10 -> 0-unstable-2024-11-10
7c6c04825999 hyprlandPlugins/hyprland-plugins: 0.44.0 -> 0.45.0
e2b798c525ac hyprlandPlugins.hy3: 0.44.0 -> 0.45.0
e575fc8ffa4b hyprland: 44.1 -> 45.0 (#354900)
62d3c4fb592b netsurf.browser: fix darwin builds
0ef26b5dd615 Merge: Linux Hardened Kernel Updates for 2024-11-10 (#355023)
a6f2dfc2572d pylyzer: 0.0.69 -> 0.0.70 (#354954)
91333a0e6dcd team-list: establish java team (#352938)
6b0d4d7f4e8e aquamarine: 0.4.3 -> 0.4.4
3024a6807634 python3Packages.subliminal: mark as not broken (#353672)
fa1ebbeeff0a python312Packages.wordcloud: 1.9.3 -> 1.9.4
4fee2cde561f brave: 1.71.121 -> 1.71.123; refactor and nixfmt-rfc-style (#354114)
44bbe5ddad08 nixos/{boinc,guix}: Use exec to start the payload binary of the service (#297526)
9bd781e73301 linux/hardened/patches/6.6: v6.6.59-hardened1 -> v6.6.60-hardened1
3b3ea3ac4b03 linux/hardened/patches/6.11: v6.11.6-hardened1 -> v6.11.7-hardened1
d9b6a745b265 linux/hardened/patches/6.1: v6.1.115-hardened1 -> v6.1.116-hardened1
c367b19a22b7 linux/hardened/patches/5.4: v5.4.284-hardened1 -> v5.4.285-hardened1
fc9089929ad5 linux/hardened/patches/5.15: v5.15.170-hardened1 -> v5.15.171-hardened1
edb9a963e6ea linux/hardened/patches/5.10: v5.10.228-hardened1 -> v5.10.229-hardened1
8db0ec767e6d home-assistant-custom-components.better_thermostat: 1.6.0 -> 1.6.1 (#355021)
2544da75c5bf home-assistant-custom-lovelace-modules.dirigera_platform: init at 2.6.4 (#350542)
799b1af3b445 cfn-nag: fix gemfile so that binaries are generated (#353735)
8339db676638 home-assistant-custom-components.better_thermostat: 1.6.0 -> 1.6.1
9e1f7a1fc712 libvirt: 10.5.0 -> 10.9.0 (#353684)
6977c6b6c48e piano-rs: init at 0.2.0
e4c62c1fc494 pylyzer: 0.0.69 -> 0.0.70
fd214590b6ac rime-zhwiki: init at 20240909
f5f87e7240f5 dashy-ui: init at 3.1.1-unstable-2024-07-14 (#349149)
08e65e669ae3 python312Packages.tensorflow-probability: 0.24.0 -> 0.25.0
608a4a6e7042 libsForQt5.accounts-qml-module,lomiri.*: Enable qdoc docs (#352601)
f4a76ebd1330 waylock: 1.2.1 -> 1.3.0 (#354685)
6eafb43ca667 python312Packages.androidtv: 0.0.74 -> 0.0.75 (#354948)
926dbc8e1c6a jasp-desktop: add patch to fix crash when using qt 6.8 (#352505)
60190159408f gfn-electron: init at 2.1.2
9a333460f50c Merge: postgresql: improve passthru.tests (#352966)
0598c612417e python312Packages.bsdiff4: 1.2.4 -> 1.2.5 (#352452)
d40ed47baac0 python312Packages.pyftgl: fix build on darwin; fix source; refactor and modenize (#354973)
d77a2129f3e2 zed-editor: make node-based built-in LSPs work on NixOS (#354063)
4e73fc3d5304 release: block on `aarch64` on `*-darwin` channels (#262038)
37c3c1a32edf python312Packages.morecantile: 5.4.2 -> 6.0.0 (#349069)
43544b405735 containerlab: 0.58.0 -> 0.59.0 (#353113)
3e9874330416 regripper: update-2023-07-23 -> 0-unstable-2024-11-02 (#353377)
88b78b3d1881 gtree: 1.10.11 -> 1.10.12 (#354521)
83d30478782d python312Packages.kornia: 0.7.3 -> 0.7.4 (#354350)
93472981d1ff nest-cli: 10.4.5 -> 10.4.7 (#354452)
886b26bad3d5 vassal: 3.7.14 -> 3.7.15 (#354462)
b1d782c6fbb9 kube-state-metrics: 2.13.0 -> 2.14.0 (#354503)
3e3d0f2c68cf openlibm: 0.8.3 -> 0.8.4 (#354964)
38ed0b172a2e compose2nix: 0.2.3 -> 0.3.1 (#354858)
c8af02ff2edb kine: 0.13.2 -> 0.13.3 (#354916)
3a92760aa3f9 stardust-xr-kiara: 0-unstable-2024-07-07 -> 0-unstable-2024-07-13 (#354775)
b6077e3f6067 python312Packages.dinghy: 1.3.2 -> 1.3.3 (#354801)
84db55f55e00 erg: 0.6.45 -> 0.6.47 (#354818)
d932f3609c38 python312Packages.xml2rfc: 3.23.2 -> 3.24.0 (#354827)
cb0631fce111 dotenvx: 1.14.2 -> 1.22.0 (#354838)
1c7bb9a36ff7 jan: 0.5.6 -> 0.5.7 (#354845)
9dcf68f72882 pik: 0.9.0 -> 0.10.0 (#354901)
85a894514e94 dbmate: 2.21.0 -> 2.22.0 (#354985)
77c379fc15b1 maintainers/README: add guidelines for committers
aebe24954483 ox: 0.6.7 -> 0.6.10 (#354280)
2b05865a6fa6 glfw3: added vulkan support (#354761)
72d2fc0fe01c python312Packages.polars: 1.7.1 -> 1.12.0 (#354656)
57fa23936966 python3Packages.globus-sdk: fix test
4b239e8fff18 python3Packages.globus-sdk: add bot-wxt1221 as maintainers
2b76729d1341 python312Packages.aiogram: 3.13.1 → 3.14.0 (#354881)
3bfe9c23d14e clickhouse-backup: 2.6.2 -> 2.6.3 (#354882)
67e295df4455 python312Packages.chess: 1.11.0 -> 1.11.1 (#354892)
123c88831bff komga: 1.14.0 -> 1.14.1 (#354826)
57fb3a800a9a xml2rfc: 3.23.2 -> 3.24.0 (#354829)
c9ba25afb896 go-mockery: 2.46.0 -> 2.46.3 (#354844)
9d40f67872f2 octoprint: 1.10.2 -> 1.10.3 (#354848)
1d2941554a10 dbmate: 2.21.0 -> 2.22.0
45f61aa9a947 python312Packages.stravalib: 2.0 → 2.1 (#354851)
e01ca8d232a0 wit-bindgen: 0.33.0 -> 0.34.0 (#354853)
090349a58995 nwg-drawer: 0.5.0 -> 0.5.2 (#354856)
a7fcea08bca8 miriway: 24.09 -> 24.10.1
8025d6d17bcd typos: 1.26.0 -> 1.27.3
da9757048d7d buck2: Use stdenvNoCC
982ff0b08e25 buck2: Install completions for bash and zsh
8213a8a557f8 surreal-engine: init at 0-unstable-2024-11-08 (#337069)
6d4ddefd7161 positron-bin: fix darwin not unpacking the dmg (#354846)
494908f0fe86 python312Packages.localstack: fix build and refactor
54394a0c0b71 python312Packages.localstack-ext: fix build and refactor
5b916fd89714 nixos/openvpn3: add `/etc/openvpn3/configs` to `systemd.tmpfiles` (#353832)
822590d06248 python3Packages.protobuf4: disable tests that fail on 32bit
e9c53bdf9a56 nixos/localsend: add package option & allow udp port (#333485)
da404cffefb6 vgmtrans: init at 1.2, libbassmidi: init at 2.4.15.3 (#321129)
551bd11c42de python312Packages.pyftgl: refactor and modenize
beceecb51336 python312Packages.pyftgl: fix source
8618fe6f96b9 python312Packages.pyftgl: fix build on darwin
9828bad63a49 completely: 0.5.2 -> 0.6.3
8f8f60bee8e5 cvise: 2.10.0 -> 2.11.0
66c47da4338c prettypst: unstable-2023-12-06 -> unstable-2024-10-20
88b620a72b65 completely: move to by-name
00cd61f517aa cartridges: 2.9.3 -> 2.10.1 (#354306)
6cd1dd3dc5e6 vscode-extensions.esbenp.prettier-vscode: 10.4.0 -> 11.0.0 (#335742)
f7911fc460e9 vscode-extensions.continue.continue: 0.8.44 -> 0.8.54 (#342514)
f69f13279107 vscode-extensions.sainnhe.gruvbox-material: init at 6.5.2 (#350464)
e065e550b153 python3Packages.us: add bot-wxt1221 as maintainers
ef21cc74e2f1 python3Packages.us: switch to pyproject
925510d32cab vscode-extensions.streetsidesoftware.code-spell-checker: 4.0.14 -> 4.0.15 (#353989)
dbb60b6319f3 vscode-extensions.shd101wyy.markdown-preview-enhanced: 0.8.14 -> 0.8.15 (#354447)
f696e0dc331c crates-tui: init at 0.1.20 (#354307)
46bbcb7efef5 vgmtrans: init at 1.2
07ca74e13487 teamviewer: add services.teamviewer.package Option + misc improvemens (#346365)
fc94ad90fb0e phonemizer: add bot-wxt1221 as maintainers
42be8c49fb89 phonemizer: fix build
1531e7712628 typos-lsp: 0.1.27 -> 0.1.30 (#354872)
e19b3c8cd386 python312Packages.netifaces2: init at 0.0.22 (#354736)
fc1d56201e17 openlibm: 0.8.3 -> 0.8.4
b306e97ffe30 Libreoffice updates (#354456)
62fa59a63947 doc: revise Darwin SDK documentation (#353439)
29ba5b9a2985 xcodes: 1.5.0 -> 1.6.0, move to `by name`, `with lib;` cleanup, RFC format (#354932)
eee079f7e129 xcodes: nix-rfc-format
b45f61402b8a xcodes: with lib; cleanup
7531c8e01dc8 xcodes: 1.5.0 -> 1.6.0
3912015f1d0d python312Packages.androidtv: 0.0.74 -> 0.0.75
d420f2c9502f maintainers: add llakala (#354625)
757189b3e6b0 vscode-extensions.ms-windows-ai-studio.windows-ai-studio: init at 0.6.1 (#354817)
214d9423dca6 python312Packages.langgraph: Use correct test directory (#354345)
647624dca6a1 wine-discord-ipc-bridge: unstable-2023-08-09 -> 0.0.3 (#353900)
4c78072d2f27 python312Packages.guidata: 3.6.3 -> 3.7.1 (#354168)
3efeb317473e git-warp-time: init at 0.8.4 (#354046)
35305f29a7e3 xar: fix Linux build on staging-next (#352507)
01ddc69668f5 obsidian: remove white background from icons
903f42960df7 fishPlugins.*: fix versions (#354729)
b0b3a70891e6 buildFHSEnv: use LOCALE_ARCHIVE from environment if present (#354899)
c188d417cf07 python312Packages.soco: 0.30.5 -> 0.30.6
d3cba66b117d python312Packages.millheater: 0.11.8 -> 0.12.0 (#354797)
4af121e6ac0f ov: 0.36.0 -> 0.37.0 (#354807)
96e67743abd9 ox: switch to the new darwin sdk pattern
992c80c02e1f ox: 0.6.7 -> 0.6.10
757df4a1b42e xcodes: move to by-name
ae21c33fafab python312Packages.debugpy: 1.8.7 -> 1.8.8
1bd58487d015 python312Packages.scikit-rf: 1.3.0 -> 1.4.1
343b0a222530 adolc: modernize; fix clang build (#354642)
27235e1e6da6 python312Packages.google-generativeai: 0.8.2 -> 0.8.3
1e6362fe068f python312Packages.google-ai-generativelanguage: 0.6.10 -> 0.6.12
9d3096074f3e vale: 3.8.0 -> 3.9.0 (#354444)
9e960c976873 python312Packages.google-cloud-bigquery-logging: 1.4.5 -> 1.5.0
16107665062c dolphin-emu-primehack: 1.0.6a -> 1.0.7a, qt5 -> qt6, unpin fmt (#350053)
b3765ba04029 d2: 0.6.7 -> 0.6.8 (#354459)
012a679db0f8 python312Packages.stripe: 11.1.0 -> 11.2.0 (#354852)
6ffb12c9f9c3 kine: 0.13.2 -> 0.13.3
27a103786c88 doc/hooks/aws-c-common: init (#351394)
660022ee302b newlib: enable parallel build (#354520)
acf406372cf8 linux_xanmod, linux_xanmod_latest: 2024-11-08 (#354617)
ab244d13144a python312Packages.aiogram: update disabled
bb00b359cce7 ggshield: 1.32.2 -> 1.33.0
b39ea623743c python312Packages.tencentcloud-sdk-python: 3.0.1262 -> 3.0.1263
4c4420b29b66 python312Packages.pyswitchbot: add pytest-asyncio
b1d0a1aafff5 python312Packages.reolink-aio: 0.10.4 -> 0.11.0b1
465eab85d222  python312Packages.playwrightcapture: 1.26.3 -> 1.27.0, python312Packages.lacuscore: 1.11.3 -> 1.12.0 (#353963)
85c8b5ba7879 esphome: 2024.10.2 -> 2024.10.3 (#354880)
c00d32f28515 beszel: init at 0.6.2 (#345444)
652fd5119056 pik: 0.9.0 -> 0.10.0
a59e625bb474 buildFHSEnv: use LOCALE_ARCHIVE from environment if present
f8a4abdc2ed1 python312Packages.pytest-flake8: 1.2.2 -> 1.3.0
e20360e289da leo-editor: 6.8.1 -> 6.8.2 (#354519)
eacbe35bf009 python312Packages.babelfont: 3.0.5 -> 3.0.6 (#354574)
72a790c6fc77 prusa-slicer, super-slicer, mediathekview: remove Moredread as mainta… (#354794)
de131566b6e4 gh-dash: 4.7.0 -> 4.7.1 (#354813)
12fe26865622 python312Packages.magic-wormhole-transit-relay: 0.3.1 -> 0.4.0 (#354726)
176eb0a3d99e doc/hooks/aws-c-common: init
8df19efae58d kubelogin-oidc: 1.30.1 -> 1.31.0 (#353577)
f0000fe56d08 lib/minver: bump to 2.3.17 (#354586)
09efcc6e4be9 libvirt-glib: relax max stack size limit
f91d2228a0b7 pantheon.elementary-onboarding: 8.0.1 -> 8.0.2
74d1b07edbf2 htcondor: 23.10.1 -> 24.1.1 (#353342)
28f456e3131c GNOME updates 2024-11-05 (#353824)
59ed3fa2c48d scarab: Apply scaling factor in Wayland
0a0d12f6626d gtree: 1.10.11 -> 1.10.12
1a4eb8b7a96e libnvme: 1.10 -> 1.11
35110b71bd78 azure-storage-azcopy: 10.26.0 -> 10.27.0
464b1e80245f maintainers: add llakala
d1444b4947b4 python312Packages.chess: 1.11.0 -> 1.11.1
08c2eb8e894e nest-cli: 10.4.5 -> 10.4.7
061f86ca2988 vassal: 3.7.14 -> 3.7.15
ca3eca77cd85 gcsfuse: mark as broken on darwin
64b28c617d26 gcsfuse: 2.4.0 -> 2.5.1
2ff82ba8deea libdatachannel: 0.21.2 -> 0.22.2
8ff9d62e81f6 yubioath-flutter: 7.1.0 -> 7.1.1
b49da1f76456 scarab: Remove unused inputs
df10ec72acee mysql-shell: add libutil on darwin; refactor to new SDK pattern (#354735)
b9c73c537391 python311Packages.tsfresh: fix build on darwin (#354667)
ae7f0eebdb3b python311Packages.qutip: relax numpy build-time constraint, unbreak (#354592)
6e82927b9473 python312Packages.phonopy: 2.28.0 -> 2.29.1, fix build
dde8f5051682 bsc: remove axv2 when building on non x86 system (#354473)
55242bf389de hyprland: 44.1 -> 45.0
97a1ad0df003 tulip: fix build (#354236)
b322800344d5 python312Packages.rapidfuzz: 3.10.0 -> 3.10.1
ff18a1b2578d rapidfuzz-cpp: 3.0.5 -> 3.1.1
0dc5bb1584a5 mesonlsp: 4.3.5 -> 4.3.7 (#345407)
7135b364b6e3 brave: 1.71.121 -> 1.71.123
301751f1c1bb brave: format with nixfmt-rfc-style
d037904ba3ed brave: refactor package.nix to allow more architectures
e3d50903923e hickory-dns: 0.25.0-alpha.2 -> 0.25.0-alpha.3 (#354793)
b83eab78d7ec libvirt: increase timeout on darwin
b5aaa1df2248 python312Packages.redis-om: 0.3.2 -> 0.3.3 (#354393)
a96052fe5ffb virt-manager: disable testCLI0263virt_xml
df6ffb01522b perlPackages.SysVirt: 10.2.0 -> 10.9.0
e6f77dadc335 python312Packages.libvirt: 10.5.0 -> 10.9.0
69119368fdc5 libvirt: 10.5.0 -> 10.9.0
ed887863a6d6 clickhouse-backup: 2.6.2 -> 2.6.3
06486aa31e8c python312Packages.aiogram: 3.13.1 → 3.14.0
7f76ced7336f nixos/dashy: init module
60bc80aa5cd7 dashy-ui: 3.1.1-unstable-2024-07-14
ec1f3c7390de wttrbar: 0.10.6 -> 0.11.0 (#354778)
372f9fa1b449 esphome: 2024.10.2 -> 2024.10.3
1546e0871c1d nomad_1_9: 1.9.0 -> 1.9.2 (#354300)
3cebba8819f4 spotify-player: 0.20.0 -> 0.20.1
3a83ddd0062b vimPlugins.neoconf-nvim: add dependencies (#354673)
e6ffd9960ec9 python3Packages.{mirakuru,pgsanity}: fix builds (#354774)
8bee32d8bfa3 maintainers: add caperren
06be8564e527 immich: 1.119.1 -> 1.120.1 (#354083)
6648da3db4c4 darwin.openwith: remove apple_sdk.frameworks (#354766)
bbdf7817f839 wibo: 0.4.2 -> 0.6.14
a329ca6aea6e immich: unvendor exiftool
ee1cffa25c45 immich: 1.119.1 -> 1.120.1
d6899545c5bf typos-lsp: 0.1.27 -> 0.1.30
73e03e065ec8 luaPackages.toml-edit: 0.6.0 -> 0.6.1
2b3acacf0856 pyton312Packages.arelle: 18.3 -> 2.30.25, unbreak, refactor (#337284)
d55bf75cb9fe python312Packages.uuid6: fix package version metadata (#354857)
5e5ec22c6f3d skia: unbreak darwin (#354557)
c00cc16b63b0 home-assistant-custom-components.moonraker: 1.3.7 -> 1.4.0 (#354863)
93a01b05975a teamspeak3: drop 'arch' variable
2ad379b1c350 panoply: 5.5.4 -> 5.5.5 (#354771)
10a4498042d9 home-assistant-custom-components.moonraker: 1.3.7 -> 1.4.0
c48cd19fe52a python312Packages.uuid6: fix package version metadata
25628a6ed53a python3Packages.{consonance,yowsup}: fix build; refactor (#354690)
3bb8fc0f8844 compose2nix: 0.2.3 -> 0.3.1
e4ea814f0c8e teamspeak3: avoid `with lib;`
585c5ae3bcfa teamspeak3: remove NIX_REDIRECTS
4d98fc18e856 teamspeak3: rename from teamspeak_client
05eff5c687c1 python3Packages.torch: switch to apple-sdk_13 (#351778)
e5017770eb89 teamspeak_client: run installer script without -x by default
2568cfa34889 teamspeak_client: install to opt/ subdirectory
3830a3dbf641 teamspeak_client: modernise installPhase
49a5c6431cb9 teamspeak_client: remove unnecessary dependencies
9db530c94c90 teamspeak_client: use autoPatchelfHook rather than manual patchelf
cba4002e45b3 teamspeak_client: refactor libquazip patching
1a5940c3e8b3 teamspeak_client: use wrapQtAppsHook
56a739f756c9 teamspeak_client: make libredirect a regular runtimeDep
0f029a19c62b teamspeak_client: run phase hooks
cdd40cb89c34 teamspeak_client: refactor QT deps
c056c7dd7a11 teamspeak_client: use regular libcxx
f3840380fd31 teamspeak_client: don't wrap with cc's libdir
168a80a4eaea nwg-drawer: 0.5.0 -> 0.5.2
e3893e5c3c76 python312Packages.python-axolotl-curve25519: fix build (#354706)
031786067bea slint-lsp: remove obsolete libXrandr input
e70954dca60d alacritty: remove obsolete libXrandr input
3690e2cfea0d python312Packages.mypy-boto3-*: updates (#354714)
414bf9701593 python312Packages.chromadb: 0.5.17 -> 0.5.18 (#354715)
ce51df0a5ba5 python312Packages.gehomesdk: 0.5.28 -> 0.5.29 (#354716)
cec3c09abdec cnspec: 11.28.1 -> 11.29.0 (#354722)
8bfbd4e1f8d3 python312Packages.cyclopts: 2.9.9 -> 3.0.0 (#354719)
b003bd16857f wit-bindgen: 0.33.0 -> 0.34.0
32cd6d84d744 python312Packages.msgraph-sdk: 1.11.0 -> 1.12.0 (#354816)
63a139ae1c3c python312Packages.millheater: refactor
bcbe1d7185f3 python311Packages.angr: 9.2.126 -> 9.2.127 (#354742)
92e125410c20 python312Packages.stripe: 11.1.0 -> 11.2.0
acc043c769ce python312Packages.stravalib: 2.0 → 2.1
43fa5ea2c9aa sketchybar-app-font: 2.0.25 -> 2.0.27 (#354779)
8540b13b1d20 josm: 19230 → 19253 (#354506)
f8486a3f1d9c vscode-extensions.sourcery.sourcery: 1.23.0 -> 1.24.0 (#354612)
d87258ad94bd python311Packages.pymc: fix hash (#354840)
13c119bf1a64 .github: Add a "Module requests" issue template (#342713)
2212fad7704e laravel: 5.8.3 -> 5.9.2 (#354696)
ebc1473d52f3 octoprint: 1.10.2 -> 1.10.3
d429e8592fb8 python312Packages.wtforms: 3.1.2 -> 3.2.1 (#350180)
da39eb7dd037 treewide: use dontCargo{Build,Check,Install} (#354024)
0120ed5ea9f1 ruffle: remove obsolete libXrandr input
77c0b0b54457 halloy: remove obsolete libXrandr input
68d10c6cc3bb cosmic-term: remove obsolete libXrandr input
86d824132693 cosmic-edit: remove obsolete libXrandr input
f641f65b03b4 chiptrack: init at 0.3.1 (#320790)
d91e9dd0faa5 cosmic-comp: remove obsolete libXrandr input
a0bc021caebf coppwr: remove obsolete libXrandr input
2dcf8afc6007 aider-chat: add playwright version (#354796)
499926182ad1 positron-bin: fix darwin not unpacking the .dmg
3d3185b49655 proton-ge-bin: GE-Proton9-18 -> GE-Proton9-20
52c3ce5d48fe qownnotes: 24.9.8 -> 24.11.1 (#354770)
7cb44f20f6b3 zed-editor: make node-based built-in LSPs work on NixOS
658a8762ea0d jan: 0.5.6 -> 0.5.7
b2f43234a2c3 adolc: fix clang build
5186ad13f487 adolc: modernize
c880f1f46bfe adolc: format
f3cced0b682e python312Packages.pyosmium: 4.0.1 -> 4.0.2 (#354831)
a806a3b2e597 python311Packages.pymc: fix hash
9a695a958884 go-mockery: 2.46.0 -> 2.46.3
1cd03b9a6446 dotenvx: 1.14.2 -> 1.22.0
50cff47c417c bootterm: init at 0.5 (#352951)
0927ff824cde python3Packages.rioxarray: 0.17.0 -> 0.18.1 (#354630)
e42a71a5de98 krabby: 0.2.0 -> 0.2.1 (#354812)
df1e170e33c5 python312Packages.pyosmium: 4.0.1 -> 4.0.2
92c3f8cf92c0 wasmer: 5.0.0 -> 5.0.1 (#354116)
8ac37da4f6ed xml2rfc: 3.23.2 -> 3.24.0
7ecad5abbd99 maintainers: add therealgramdalf
fe17e8dfaa6b python312Packages.xml2rfc: 3.23.2 -> 3.24.0
b323e1c5c4e2 komga: 1.14.0 -> 1.14.1
c04d7170e047 team-list: establish java team
8b2a02dc9de8 vscode-extensions.ms-windows-ai-studio.windows-ai-studio: init at 0.6.1
146c62ba33a4 vscode-extensions.ms-vscode-remote.vscode-remote-extensionpack: init at 0.26.0
5c44f6f77c96 nanoflann: 1.6.1 -> 1.6.2 (#354423)
21069db14d33 python312Packages.weblate-language-data: 2024.8 -> 2024.13
b71a8b49f59b live-server: 0.8.0 -> 0.9.0 (#354395)
f5e91559fddc python312Packages.cmsdials: 1.3.0 -> 1.4.0 (#354397)
286db1ef230d wasmtime: 26.0.0 -> 26.0.1 (#354412)
939318029769 erg: 0.6.45 -> 0.6.47
45cef36e39b2 nixosTests.postgresql: run nixfmt
128244b59818 nixosTests.postgresql: use a common pattern throughout all tests
9035573855d9 nixosTests.postgresql: move all postgresql related nixosTests into one folder
db2d6a00abe5 postgresqlPackages.anonymizer: make passthru.tests work with correct package
23c19a255fab postgresqlPackages.timescaledb: make passthru.tests work with correct package
6d7da20a9044 postgresqlPackages.tsja: make passthru.tests work with correct package
a5c41ae80a2f postgresqlPackages.pgvecto-rs: make passthru.tests work with correct package
0af934adf740 postgresqlPackages.pgjwt: make passthru.tests work with correct package
ecffab1fdaf8 postgresqlPackages.postgis: move nixosTests.postgis into package
aded718a9824 postgresqlPackages.apache_datasketches: move nixosTests.apache_datasketches into package
139c5466764b postgresql: add passthru.tests.postgresql-tls-client-cert
f6c2de926290 postgresql: add passthru.tests.postgresql
319d82d5c218 nixosTests.postgresql-wal2json: avoid manual imports
65ef7381c8d7 nixosTests.postgresql-jit: avoid manual imports
a1ae4377e090 nixosTests.postgresql-wal-receiver: avoid manual imports
75d51c588914 postgresqlVersions: init
d3feaaebea18 nixosTests.pgjwt: fix test
e2636cf342ea python312Packages.msgraph-sdk: 1.11.0 -> 1.12.0
3bf6a063b3c7 Merge: postgresqlPackages: fix some builds on darwin (#354748)
059fc0f2dea1 gh-dash: 4.7.0 -> 4.7.1
8f55df5aa879 krabby: 0.2.0 -> 0.2.1
f11b5ff8a21a Merge: pg-dump-anon: use latest postgresql available (#354526)
0a7544a42300 python312Packages.anthropic: 0.35.0 -> 0.39.0
b01d3ee0239c python312Packages.polars: 1.9.0 -> 1.12.0
8f3dad550fd1 python312Packages.lacuscore: 1.11.3 -> 1.12.1
446aa3f0b262 python312Packages.playwrightcapture: 1.26.3 -> 1.27.0
635e9d2ebb5b sile: switch to the zstd based source
172cb3ef53e1 openpgp-card-tools: Add shell completions and man pages (#354287)
91e4660ed8fc git-warp-time: init at 0.8.4
d60f27f889da ov: 0.36.0 -> 0.37.0
b35c45a2c174 python312Packages.imap-tools: 1.7.3 -> 1.7.4 (#354754)
31aa6f6edf2b python312Packages.nice-go: 0.3.9 -> 0.3.10 (#354750)
bba140c5a34b python312Packages.free-proxy: 1.1.2 -> 1.1.3 (#354539)
c61adda6befd python312Packages.dinghy: 1.3.2 -> 1.3.3
6430e02e54ef cotp: 1.9.1 -> 1.9.2 (#354558)
9139ad63f22f granted: 0.36.0 -> 0.36.1 (#354572)
275614510a2c python312Packages.ucsmsdk: 0.9.20 -> 0.9.21 (#354596)
cff5cbc5a1d9 python312Packages.aiortm: 0.9.24 -> 0.9.25 (#354607)
043d2cb44863 python312Packages.whenever: 0.6.10 -> 0.6.12 (#354613)
646347d50787 pulumi-bin: 3.137.0 -> 3.138.0 (#354618)
807e43e55923 msi-ec: 0-unstable-2024-09-19 -> 0-unstable-2024-11-04 (#353627)
02e3707a2cae python312Packages.jedi-language-server: 0.41.4 -> 0.42.0 (#354713)
d8a18ae783d8 python312Packages.mitogen: 0.3.16 -> 0.3.18 (#354717)
b276bfa32bff python312Packages.multiscale-spatial-image: 2.0.0 -> 2.0.1 (#354720)
df67f3f7b25a helix-gpt: 0.31.0 -> 0.34.0 (#354767)
7307a896451d home-assistant-custom-lovelace-modules.mushroom: 4.0.8 -> 4.1.0 (#354787)
9559e9044e8a python312Packages.qbittorrent-api: 2024.9.67 -> 2024.10.68 (#354681)
45d7d8c8b3cd python312Packages.millheater: 0.11.8 -> 0.12.0
3061dbd29c06 ab-av1: 0.7.18 -> 0.7.19 (#354684)
3be1322ad99d python312Packages.objprint: 0.2.3 -> 0.3.0 (#354693)
a8e970898daa ccls: 0.20240505 -> 0.20241108 (#354698)
d5df6af63621 python312Packages.tencentcloud-sdk-python: 3.0.1261 -> 3.0.1262 (#354699)
2bac553f5a50 okteto: 3.0.0 -> 3.1.0 (#354702)
d7a60669490e ocamlPackages.http-mirage-client: 0.0.7 -> 0.0.8 (#354650)
011f48fb221a fluent-bit: 3.1.9 -> 3.1.10 (#354664)
f8ba284376ec python312Packages.guidata: 3.7.0 -> 3.7.1
d9353697ca64 tile38: 1.33.3 -> 1.33.4 (#354674)
4f101cae7065 aider-chat: add playwright version
7953deea2419 keybase-gui: 6.2.4 -> 6.4.0 (#336886)
20e8995972d4 thunderbird: 128.4.0esr -> 128.4.2esr (#354213)
312ce1b65c40 hickory-dns: 0.25.0-alpha.2 -> 0.25.0-alpha.3
b89f8a710d16 prusa-slicer, super-slicer, mediathekview: remove Moredread as maintainer
d2d4c4f350b9 restic: 0.17.2 -> 0.17.3 (#354582)
38a52bbfd430 restic: disable tests on non-linux
c98b0cad092c home-assistant-custom-lovelace-modules.mushroom: 4.0.8 -> 4.1.0
70ca880f3511 gnome-online-accounts: 3.52.0 → 3.52.1
247ee3b0379e mutter: 47.0 → 47.1
6b438be4d92a gvfs: 1.56.0 → 1.56.1
748ada2ba6e0 gnome-shell-extensions: 47.0 → 47.1
b3b9989a367d gnome-shell: 47.0 → 47.1
d45192210e86 gnome-remote-desktop: 47.0 → 47.1
ea1a562cb95a gnome-control-center: 47.0.1 → 47.1.1
9b6dabf3f2ff kubelogin-oidc: switch to recommended pattern for implicit attr defaults
4d089cffa925 kubelogin-oidc: 1.30.1 -> 1.31.0
f0bee68628ec robo: 5.0.0 -> 5.1.0 (#354707)
6fb6032d36ef roave-backward-compatibility-check: 8.9.0 -> 8.10.0 (#354705)
04f72b6930e8 ispc: 1.25.0 -> 1.25.3 (#354585)
a4e298635f25 waylock: 1.2.1 -> 1.3.0
7fa514f53139 waylock: port update script to bash
a9669e1be8c7 d2: 0.6.7 -> 0.6.8
a31f2a7b37f2 pluginupdate.py: fix bugs and add improvements; vimPlugins: sort properly (#353786)
8d9c4bfb9851 helix-gpt: 0.31 -> 0.34
2ef132b3585e gifski: 1.14.4 -> 1.32.0 (#346255)
e02828f01cd1 python312Packages.scikit-fmm: remove stale substituteInPlace, unbreak (#354509)
7bb5dfe0e470 sketchybar-app-font: 2.0.25 -> 2.0.27
894ab7c90845 wttrbar: 0.10.6 -> 0.11.0
bc63a2f7c3c8 lapce: unbreak x86_64-darwin (#354566)
dcdd61e5e5b2 whitesur-kde: 2022-05-01-unstable-2024-09-26 -> 2022-05-01-unstable-2… (#353112)
67fa71469a6b python3Packages.pgsanity: fix build
e07f6a75653d python3Packages.mirakuru: fix build on darwin in sandbox
1b89b9a99d80 python3Packages.mirakuru: fix build on darwin
2515edf5369e qogir-kde: 0-unstable-2024-09-21 -> 0-unstable-2024-10-30 (#352723)
5f45ecf05c14 python312Packages.docling-parse: 2.0.2 -> 2.0.3 (#354691)
cf6a8c9b4b9f chore: update references to `nix-review` to `nixpkgs-review`
bc5b75eb11b1 mysql80: 8.0.39 -> 8.0.40 (#350248)
9bcab985ab58 stardust-xr-kiara: 0-unstable-2024-07-07 -> 0-unstable-2024-07-13
ea5908112814 python3Packages.mirakuru: 2.5.2 -> 2.5.3
a2dc61cee92a panoply: 5.5.4 -> 5.5.5
9ba75eb753b5 mysql-shell-innovation: add libutil on darwin; refactor to new SDK pattern
194e35dd632a mysql-shell: add libutil on darwin; refactor to new SDK pattern
54953ef09a04 qownnotes: 24.9.8 -> 24.11.1
8091ea3f24bb Merge: postgresql_17: fix build (#354571)
274d5afbc552 python312Packages.githubkit: 0.11.11 -> 0.11.14
3b91a81423cd treewide: remove redundant patches and locks (#354215)
c4f452f621f6 vimPlugins.neoconf-nvim: add dependencies
c701c72b71f7 wl-gammarelay-rs: 0.4.1 -> 1.0.0 (#353023)
b11943b30173 nhost-cli: 1.24.5 -> 1.27.0 (#352589)
82f6fe5a5762 OWNERS: correct path after 1st by-name migration (#354753)
44800d7c800e .git-blame-ignore-revs: add 'treewide: migrate packages to pkgs/by-name, take 1'
7a56cc79c651 marwaita-red: 22 -> 22.2 (#354662)
fa2cae8e77f8 treewide: migrate packages to pkgs/by-name, take 1 (#354531)
8f29f19bc162 mysql-shell: 8.4.1 -> 8.4.3, mysql-shell-innovation: 9.0.1 -> 9.1.0 (#349181)
8c2c5fa14d77 nixos/nzbget: add option to override package (#302204)
f8bb0b875ad8 factorio: 2.0.14 -> 2.0.15 (#354040)
ff0df8fe7aee php: 8.4.0RC3 -> 8.4.0RC4, 8.3.12 -> 8.3.13 (#354562)
751912c95af1 OWNERS: correct path after 1st by-name migration
648e59c8a3ce python312Packages.imap-tools: 1.7.3 -> 1.7.4
be978743512b Fix: use lib.mkPackageOption
ba83a0dba006 Merge branch 'master' into patch-1
a96dce89d048 PR feedback: Replace pkg variable, move package statement
571c71e6f73a treewide: migrate packages to pkgs/by-name, take 1
b5f67acfbf3c nix-forecast: init at 0.1.0 (#354661)
bfd5f3d9ffca glfw3: added vulkan support
e98f8506648f python312Packages.nice-go: 0.3.9 -> 0.3.10
e79b71782a4c budgie-media-player-applet: 1.0.1 -> 1.1.1 (#354308)
4801d0c2a3a5 postgresql17Packages.{pg_cron,pg_hll}: fix build on x86_64-darwin
b9cf08c8e5ec cargo-mobile2: 0.17.3 -> 0.17.4 (#354677)
dde21924f83f vimPlugins.quarto-nvim: add dependencies (#354634)
df20742283ba ombi: allow overriding package in module (#345814)
a50d7295727e darwin.openwith: remove apple_sdk.frameworks
112d505ce4a2 clickhouse: fix compilation on aarch64-linux (#353983)
3fe7c149cbbb libreoffice: disable tests on Qt5
2be7c57b9325 python312Packages.ruff: 0.7.2 -> 0.7.3 (#354580)
eeb4b7041961 nixos/hebbot: Fix systemd service (#354098)
dde890851a3c python311Packages.angr: 9.2.126 -> 9.2.127
58e6cb8ad805 python312Packages.cle: 9.2.126 -> 9.2.127
7a83dade0a7d python312Packages.claripy: 9.2.126 -> 9.2.127
82870db16ad2 python312Packages.pyvex: 9.2.126 -> 9.2.127
1e20869209d8 python312Packages.ailment: 9.2.126 -> 9.2.127
5a5694d2ff97 python312Packages.archinfo: 9.2.126 -> 9.2.127
bf11ccc0e233 clouddrive2: 0.7.21 -> 0.8.3 (#354273)
951d196036af stardust-xr-magnetar: init at 0-unstable-2024-08-31 (#354623)
18f2cc30ef90 stardust-xr-gravity: init at 0-unstable-2024-08-20 (#354616)
90f890e79327 stardust-xr-atmosphere: init at 0-unstable-2024-08-22 (#354633)
fd3e1541866a libreoffice-still: 24.2.5.2 -> 24.2.7.2
b60b7b6b05c1 libreoffice-fresh: 24.8.0.3 -> 24.8.2.1
dc31ff18ec84 stardust-xr-phobetor: init at 0-unstable-2024-02-10 (#354637)
996e9d64594d python311Packages.pysnow: fix deps and tests, unbreak (#354464)
5f8f11ff862b stardust-xr-protostar: init at 0-unstable-2024-07-19 (#354614)
f3e2ba5038e9 stardust-xr-sphereland: init at 0-unstable-2023-11-06 (#354638)
99d3107b49fe stardust-xr-flatland: init at 0-unstable-2024-04-13 (#324395)
780275051aa2 stardust-xr-kiara: init at 0-unstable-2024-07-07 (#324404)
ff09150750be basedpyright: 1.19.0 -> 1.21.0 (#354204)
aff0cebe5ab3 fishPlugins.*: fix versions
8b4272426c92 python312Packages.magic-wormhole-transit-relay: 0.3.1 -> 0.4.0
54baabae77a7 ssh-tools: 1.8-unstable-2024-03-18 -> 1.9 (#353042)
972dfa3efafc python312Packages.objprint: add changelog to meta
ca6c07d985d5 cnspec: 11.28.1 -> 11.29.0
788591e73b39 python312Packages.cyclopts: 2.9.9 -> 3.0.0
b156e982136d .github: Add a "Module requests" issue template
1df32493a41c python312Packages.mypy-boto3-verifiedpermissions: 1.35.30 -> 1.35.55
25114110f49e python312Packages.mypy-boto3-synthetics: 1.35.18 -> 1.35.56
dd882eb62402 python312Packages.mypy-boto3-s3control: 1.35.12 -> 1.35.55
aede3250222f python312Packages.mypy-boto3-resource-explorer-2: 1.35.25 -> 1.35.56
ddb9a7fcd1d7 python312Packages.mypy-boto3-quicksight: 1.35.43 -> 1.35.56
6db171d873a5 python312Packages.mypy-boto3-pinpoint-sms-voice-v2: 1.35.43 -> 1.35.57
c548504474ae nzportable: init at 2.0.0-indev+20241012190425
47904c8dd760 python312Packages.mypy-boto3-lambda: 1.35.49 -> 1.35.57
1e7b5db19091 python312Packages.mypy-boto3-lakeformation: 1.35.0 -> 1.35.55
f04bedb8b097 python312Packages.mypy-boto3-guardduty: 1.35.39 -> 1.35.55
f696f2da0ac9 python312Packages.mypy-boto3-firehose: 1.35.0 -> 1.35.57
815da64d5641 python312Packages.mypy-boto3-eks: 1.35.45 -> 1.35.57
da42eb80266f python312Packages.mypy-boto3-codebuild: 1.35.49 -> 1.35.55
f283f98e923e python312Packages.mypy-boto3-cleanrooms: 1.35.51 -> 1.35.56
764ae6081bc7 python312Packages.mypy-boto3-chime-sdk-media-pipelines: 1.35.0 -> 1.35.57
df705189ee44 python312Packages.mypy-boto3-batch: 1.35.53 -> 1.35.57
a4a1020e7137 python312Packages.mypy-boto3-autoscaling: 1.35.53 -> 1.35.56
e770aff17974 python312Packages.multiscale-spatial-image: 2.0.0 -> 2.0.1
f396caa8d752 python312Packages.chromadb: 0.5.17 -> 0.5.18
2160918a0b90 python312Packages.jedi-language-server: 0.41.4 -> 0.42.0
cb5a79de97b2 python312Packages.gehomesdk: 0.5.28 -> 0.5.29
ac3c8ae13d0a python312Packages.mitogen: 0.3.16 -> 0.3.18
b7c678532145 nix-update: 1.5.2 -> 1.6.0 (#354708)
1cc81439e761 nixosTests.frr: fix warning, use nodes.router instead of nodes.router.config
f93219dfa08f nixosTests.frr: format using nixfmt
df11922a6da8 nix-update: 1.5.2 -> 1.6.0
63d9179dd4e9 python312Packages.python-axolotl-curve25519: refactor
533fffa449e4 python312Packages.python-axolotl-curve25519: fix build on darwin
45dd2b73eacf python312Packages.tencentcloud-sdk-python: 3.0.1261 -> 3.0.1262
7c69e10ceb1b okteto: 3.0.0 -> 3.1.0
83d18d4dc3ee python311Packages.yowsup: refactor
c0ec6c8c3c3c python311Packages.yowsup: fix build
a0f0aac19598 ccls: 0.20240505 -> 0.20241108
5abc7f27a20e python312Packages.objprint: 0.2.3 -> 0.3.0
1fa9b80b0afd release: block on `aarch64` on `*-darwin` channels
ab7489d373ff python311Packages.consonance: refactor
c76f00a4efe6 python311Packages.consonance: fix build
f323f1ccfef7 nix-forecast: init at 0.1.0
bdfa0f011297 python3Packages.pywebview: build fix for tests
78b5698555d8 ab-av1: 0.7.18 -> 0.7.19
8dfa246bb10c python312Packages.qbittorrent-api: 2024.9.67 -> 2024.10.68
4c7aa6428fe9 cargo-mobile2: 0.17.3 -> 0.17.4
df3d7683fed1 tile38: 1.33.3 -> 1.33.4
4f0337923244 quarto: apply deno 2 compatibility patch
69cc148de30a quarto: 1.6.30 -> 1.6.33
39769f9fc86f python311Packages.tsfresh: fix build on darwin
80335810c8c6 wl-gammarelay-rs: 0.4.1 -> 1.0.0
cf772c1b5608 fluent-bit: 3.1.9 -> 3.1.10
3603e0d5ea48 marwaita-red: 22 -> 22.2
5a82dc34b00e nhost-cli: 1.24.5 -> 1.27.0
40641c90b547 python312Packages.polars: 1.7.1 -> 1.9.0
b5f7f510393d ocamlPackages.http-mirage-client: 0.0.7 -> 0.0.8
a784f38df795 stardust-xr-sphereland: init at 0-unstable-2023-11-06
2c31f63228ab stardust-xr-phobetor: init at 0-unstable-2024-02-10
66bb24d74424 vimPlugins.quarto-nvim: add dependencies
02871d95ebeb mesonlsp: fix aarch64-darwin build, mark as broken on x86_64-darwin
2e2d6027352b stardust-xr-atmosphere: init at 0-unstable-2024-08-22
e9b1d2d5ac63 vimPlugins: sort properly
a6fe798a015a pluginupdate.py: fix bugs and add improvements
8b503ec432ce pluginupdate.py: reformat with ruff
d339f93f3225 bsc: remove axv2 when building on non x86 system
385eb6ae4dff python3Packages.rioxarray: 0.17.0 -> 0.18.1
5a1e1f65a908 stardust-xr-flatland: init at 0-unstable-2024-04-13
4b02cabbbe0c stardust-xr-protostar: init at 0-unstable-2024-07-19
839ecef9050e stardust-xr-gravity: init at 0-unstable-2024-08-20
c3fd31e2c4ad stardust-xr-magnetar: init at 0-unstable-2024-08-31
a90b34f9e76b keybase{-gui}: add myself as maintainer
265d9a2adb8b keybase-gui: add `NIXOS_OZONE_WL` support
a024f81d841c keybase-gui: 6.2.4 -> 6.4.0
562758261fd4 pulumi-bin: 3.137.0 -> 3.138.0
71330f93ee9e linux_xanmod_latest: 6.11.6 -> 6.11.7
efa0718e7482 linux_xanmod: 6.6.59 -> 6.6.60
61220d768de8 python3Packages.torch: switch to apple-sdk_13
afbbb9aaeb0d python312Packages.aiortm: 0.9.24 -> 0.9.25
ac5aaaa7336f python312Packages.whenever: 0.6.10 -> 0.6.12
086bfa238585 lib/minver: bump to 2.3.17
a5b695b34b6b python312Packages.ucsmsdk: 0.9.20 -> 0.9.21
c3afba78f24e python311Packages.qutip: relax numpy build-time constraint, unbreak
0a48b45c5af7 xar: fix Linux build on staging-next
1754ed842e2d ispc: 1.25.0 -> 1.25.3
b8e62002b5d3 python312Packages.msprime: relax numpy build-time constraint, unbreak
226843be6a9f python312Packages.pysnow: patch tests, unbreak
b8b4cdc90390 doc: revise Darwin SDK documentation
5db8bf44deb0 openpgp-card-tools: Add shell completions and man pages
120103ec7cc9 restic: 0.17.2 -> 0.17.3
80458ba97944 stardust-xr-kiara: init at 0-unstable-2024-07-07
676db521744e postgresql_17: fix build
b2945bc0a84f python312Packages.langgraph: Fix unit tests that were breaking Hydra
c64c064437f5 python312Packages.babelfont: 3.0.5 -> 3.0.6
c26249be9a66 lapce: format with nixfmt-rfc-style
896db32853f5 lapce: unbreak x86_64-darwin
3e9c905d355a nomad_1_9: 1.9.0 -> 1.9.2
4a1393afe0f1 python312Packages.ruff: 0.7.2 -> 0.7.3
78705eaeb106 skia: unbreak darwin
d1478e78c0ac postgresqlPackages.system_stats: fix build on darwin
af11b38d2131 cotp: 1.9.1 -> 1.9.2
c78b55b3b684 protonvpn-gui: 4.6.0 -> 4.7.3
29d02718132f wasmtime: 26.0.0 -> 26.0.1
1af3b8486fb2 granted: 0.36.0 -> 0.36.1
1bb3362ddfb5 python312Packages.free-proxy: 1.1.2 -> 1.1.3
dd59f2cfe919 budgie-media-player-applet: 1.0.1 -> 1.1.1
0418996c9685 pg-dump-anon: use latest postgresql available
6ec5b8d597ba netclient: 0.25.0 -> 0.26.0
e600b8b00b33 newlib: enable parallel build
16518a3f3d4b factorio: 2.0.14 -> 2.0.15
6c2d6fa844bc leo-editor: 6.8.1 -> 6.8.2
84b68b839ac3 python312Packages.tskit: relax numpy build-time constraint, unbreak
bd2ea530520b python312Packages.scikit-fmm: run checkPhase hooks, echo check command
1c418186cfd2 python312Packages.scikit-fmm: remove stale substituteInPlace, unbreak
ee27c02106f3 kube-state-metrics: 2.13.0 -> 2.14.0
0465be1b8f0e python311Packages.pysnow: fix deps, unbreak
eeb52b79d149 vscode-extensions.shd101wyy.markdown-preview-enhanced: 0.8.14 -> 0.8.15
19595c35d78c crates-tui: init at 0.1.20
92647d759237 vale: 3.8.0 -> 3.9.0
44992762f0cc basedpyright: 1.19.0 -> 1.21.0
27c93e95f9a8 tulip: fix compilation by adding the `-fpermissive` flag A typecast from unsigned char* to char* in the source broke the build
987c737557b1 python312Packages.guidata: 3.6.3 -> 3.7.0
07d2ee58bae2 nanoflann: 1.6.1 -> 1.6.2
b74fdd238641 treewide: remove redundant patches and locks
a588dee7465d python312Packages.cmsdials: 1.3.0 -> 1.4.0
b75334c2f965 live-server: 0.8.0 -> 0.9.0
86fbc2f2d8c6 python312Packages.redis-om: 0.3.2 -> 0.3.3
00cc5342828c python312Packages.kornia: 0.7.3 -> 0.7.4
831c38e31987 python3Packages.fastcrc: init at 0.3.2
a01b23fa72ac cartridges: run meson checks
57f23ed8b1a8 cartridges: 2.9.3 -> 2.10.1
cea2eef9fa5d clouddrive2: 0.7.21 -> 0.8.3
b62797a3d7ed tulip: format using nixfmt
fb358db1b51f thunderbird-128-unwrapped: 128.4.0esr -> 128.4.2esr
d56656e48729 yosys: 0.46 -> 0.47
43d0f16226c8 pyton312Packages.arelle: 18.3 -> 2.30.25, unbreak, refactor
0e174ba654b7 python3Packages.proton-vpn-network-manager: 0.9.1 -> 0.9.4
f4485f7c41af python3Packages.proton-vpn-api-core: 0.35.5 -> 0.36.4
074f93408e5a proton-vpn-local-agent: 0-unstable-2024-10-10 -> 1.0.0
da0bfe800600 signal-desktop: remove stdenv.cc.cc from runtimeDeps
de8c3feb7fbf wasmer: 5.0.0 -> 5.0.1
16970e3252d0 nixos/hebbot: Fix systemd service
9e1b88a44350 libbassmidi: init at 2.4.15.3
05ac36fa30a3 treewide: use dontCargo{Build,Check,Install}
3e646301a07e smartcat: 1.7.1 -> 2.1.0
9609ea875774 vscode-extensions.streetsidesoftware.code-spell-checker: 4.0.14 -> 4.0.15
975f4c45ae5c beszel: init at 0.6.2
887a74fd5784 clickhouse: fix compilation on aarch64-linux
3f2bbfd68b79 nixos/openvpn3: add `/etc/openvpn3/configs` to `systemd.tmpfiles`
9642cf41060a cfn-nag: added mathstlouis to maintainers
abcf5fb9b943 maintainer-list: added mathstlouis
c771f151f8bf cfn-nag: added meta.mainProgram
ff17208a821a cfn-nag: fix gemfile so that binaries are generated
dd086ca40200 msi-ec: 0-unstable-2024-09-19 -> 0-unstable-2024-11-04
4b13779f3321 python3Packages.subliminal: mark as not broken
9b7877aa1fc7 kubectl-graph: init at 0.7.0
aebe9a354b7b regripper: update-2023-07-23 -> 0-unstable-2024-11-02
db15554b6954 htcondor: 23.10.1 -> 24.1.1
d90f320eb26d bootterm: init at 0.5
45d7127c77df mesonlsp: 4.3.5 -> 4.3.7
1a774a95d219 python312Packages.wtforms: 3.1.2 -> 3.2.1
682d4d76aa8c containerlab: 0.58.0 -> 0.59.0
7abbb28c59b9 whitesur-kde: 2022-05-01-unstable-2024-09-26 -> 2022-05-01-unstable-2024-11-01
b9e3b9dbb22b ssh-tools: 1.8-unstable-2024-03-18 -> 1.9
4eceb5ba2fef maintainers: add deadbaed
c952a4bfdbec vscode-extensions.sainnhe.gruvbox-material: init at 6.5.2
d4e2d6e00c84 maintainers: add thtrf
1301e4f0b024 pyamlboot.tests: fix the eval
6030ff068ad7 gnuplot: fix build with `withTeXLive = true`
b6cf7b27b7c0 qogir-kde: 0-unstable-2024-09-21 -> 0-unstable-2024-10-30
4d8081767bc5 lomiri.lomiri-content-hub: nixfmt, modernise
4ce2e1df58ec lomiri.lomiri-download-manager: nixfmt, modernise
5cc3c54a6425 lomiri.lomiri-ui-toolkit: nixfmt, modernise
ba59f61a725a lomiri.u1db-qt: Add meta.changelog
95c0233ed962 lomiri.lomiri-action-api: nixfmt, modernise
bafb37491e96 libsForQt5.accounts-qml-module: Fix version
b8c432b54a5a libsForQt5.accounts-qml-module: nixfmt, modernise
8a5f86237dba lomiri.lomiri-content-hub: Enable qdoc docs
03b310e94cbc lomiri.lomiri-indicator-network: Enable qdoc docs
e0d5bd98ffbc lomiri.lomiri-download-manager: Enable qdoc docs
d04843ce6096 lomiri.lomiri-ui-toolkit: Enable qdoc docs
ac976c912dfb jasp-desktop: add patch to fix crash when using qt 6.8
8f74b6cdaf78 lomiri.lomiri-action-api: Enable qdoc docs
eeea8d648db2 lomiri.u1db-qt: Enable qdoc docs
4442e5ac9161 libsForQt5.accounts-qml-module: Enable qdoc docs
9dd1f943ecd1 nixos/nextcloud-notify_push: fix defaultText rendering
bed43b44613d nixos/hardware.nitrokey: update documentation
38ec993a582f nixos/hardware.nitrokey: replace libnitrokey with nitrokey-udev-rules
d43f004d1fe4 nitrokey-udev-rules: init at 1.0.0
8ffcca7fd0a0 maintainers: add robinkrahl
2280b9bf4a98 python312Packages.bsdiff4: 1.2.4 -> 1.2.5
9ce864871fdc python312Packages.rio-tiler: 6.7.0 → 7.0.1
1caf42170d5a vscode-extensions.continue.continue: 0.8.44 -> 0.8.54
d931f342a429 mysql80: 8.0.39 -> 8.0.40
07c81867c907 dolphin-emu-primehack: 1.0.6a -> 1.0.7a, qt5 -> qt6, unpin fmt
c3ceedeac1ac obs-studio-plugins.obs-hyperion: patch stateChanged deprecation
cbcee2460787 mysql-shell-innovation: 9.0.1 -> 9.1.0
c7a381c92a79 mysql-shell: 8.4.1 -> 8.4.3
933ccc51f4a5 maintainers: add rksm
1a48ff707293 python312Packages.morecantile: 5.4.2 -> 6.0.0
c02e155285ef vscode-extensions.esbenp.prettier-vscode: 10.4.0 -> 11.0.0
6e6fc7ca2658 nixos/acme: do not limit credentials functionality to DNS/S3 config
7467f7d59f13 nixos/roundcube: add example for `database.passwordFile`
04dbbd436515 teamviewer: introduce services.teamviewer.package option
2928912a7c74 teamviewer: remove "with lib;"
89ecd0313160 teamviewer: format file
5146c143bbf1 gifski: 1.14.4 -> 1.32.0
a44e0fe3dc9f pyton312Packages.sphinx-autodoc2: init at 0.5.0
0b097987fe34 nixos/localsend: allow udp port
9ac4777d98d0 nixos/localsend: add package option
a3843a7ee564 chiptrack: init at 0.3.1
5d49d4cfa1a4 nixos/guix: use exec to start the payload binary
410ae87bf5e2 nixos/boinc: use exec to start the payload binary
e8a9775a6167 nixos/nzbget: add option to override package

git-subtree-dir: third_party/nixpkgs
git-subtree-split: dc460ec76cbff0e66e269457d7b728432263166c
2024-11-16 15:43:04 +00:00

62 lines
1.8 KiB
Nix

{ lib
, stdenv
, fetchFromGitHub
, cmake
, perl
, python3
, tbb
, zlib
, runCommand
, bowtie2
}:
stdenv.mkDerivation (finalAttrs: {
pname = "bowtie2";
version = "2.5.4";
src = fetchFromGitHub {
owner = "BenLangmead";
repo = "bowtie2";
rev = "refs/tags/v${finalAttrs.version}";
fetchSubmodules = true;
hash = "sha256-ZbmVOItfAgKdsMrvQIXgKiPtoQJZYfGblCGDoNPjvTU=";
};
# because of this flag, gcc on aarch64 cannot find the Threads
# Could NOT find Threads (missing: Threads_FOUND)
# TODO: check with other distros and report upstream
postPatch = ''
substituteInPlace CMakeLists.txt \
--replace "-m64" ""
'';
nativeBuildInputs = [ cmake ];
buildInputs = [ tbb zlib python3 perl ];
cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
# ctest fails because of missing dependencies between tests
doCheck = false;
passthru.tests = {
ctest = runCommand "${finalAttrs.pname}-test" { } ''
mkdir $out
${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
${bowtie2}/bin/bowtie2-inspect-s $out/small
${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
${bowtie2}/bin/bowtie2-inspect-l $out/large
'';
};
meta = with lib; {
description = "Ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
license = licenses.gpl3Plus;
homepage = "http://bowtie-bio.sf.net/bowtie2";
changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${lib.removePrefix "refs/tags/" finalAttrs.src.rev}";
maintainers = with maintainers; [ rybern ];
platforms = platforms.all;
mainProgram = "bowtie2";
};
})