depot/pkgs/by-name/bo/bowtie2/package.nix
Luke Granger-Brown fece082f6c Squashed 'third_party/nixpkgs/' changes from d0797a04b81ca..5d67ea6b4b633
5d67ea6b4b633 clever-tools: 3.9.0 -> 3.10.1 (#360167)
7194a136ae62e hmcl: 3.5.9 -> 3.6.11 (#356397)
21e39e915f060 system/activation: mention deps attr in activationScripts example (#363915)
7ea7a19b2d52f nixos/bookstack: fix unintended escaping of nginx locations (#363581)
e898f0f29a4bd xen: mark 4.16 as EOL (#364095)
5a48e3c2e435e codesnap: init at 0.8.2 (#364266)
bbb8998e46a57 yamlscript: 0.1.83 -> 0.1.86 (#363399)
3c0501c9212e6 python312Packages.chex: 0.1.87 -> 0.1.88 (#364220)
d55cc4608dae1 nixos/immich: restrict media filesystem permissions (#361627)
a0025bee55d6d elements: 23.2.1 -> 23.2.4 (#363933)
362f987f977ae codesnap: init at 0.8.2
0f7848bc2522c flood: 4.8.2 -> 4.8.5 (#364010)
266c699413e57 squeezelite: 2.0.0.1504 -> 2.0.0.1507 (#364185)
f5c423099d9d1 ci/eval: add rebuildsByPlatform to the comparison result (#363751)
204afb3d25f51 home-assistant-custom-components.moonraker: 1.4.0 -> 1.5.0 (#364245)
87b5760efe98b moneydance: fix GTK crash (#359411)
518ae8fd583e3 ci/eval: add rebuildsByPlatform to the comparison result
ad47c13dd464d vscode-extensions.ms-toolsai.jupyter: 2024.10.0 -> 2024.11.0 (#364225)
7dca174bfedb5 pywal16: 3.6.0 -> 3.7.2; add {manpage,optional-dependencies,updateScript} (#359741)
6041b198d632c rustypaste: 0.15.1 -> 0.16.0 (#364256)
e9d754462cddb perlPackages.FinanceQuote: 1.63 -> 1.64 (#363182)
de58560d70542 python312Packages.cymem: 2.0.8 -> 2.0.10 (#364172)
1c961361c1511 python312Packages.prettytable: 3.11.0 -> 3.12.0; python312Packages.jupysql: 0.10.13 -> 0.10.16 (#359274)
cef807f7be0ec rustypaste: 0.15.1 -> 0.16.0
7251eb7213d07 edk2-uefi-shell: fix cross compilation
0592f28a344d1 codecov-cli: init at 9.1.1 (#358490)
c62feafc4a729 python312Packages.momepy: 0.9.0 -> 0.9.1 (#364177)
3bec26df1bd79 datalad: fix changed hash from upstream (#364015)
a8e642161700f python312Packages.python-linkplay: 0.1.0 -> 0.1.1 (#364023)
e626888ad91be python312Packages.cymem: update meta.changelog
d377d2b0a509c codecov-cli: init at 9.1.1
d74689ac642e8 libretro.nestopia: 0-unstable-2024-10-17 -> 0-unstable-2024-12-10 (#364017)
6c6fcb1793134 libretro.bluemsx: 0-unstable-2024-10-22 -> 0-unstable-2024-12-04 (#364022)
6e1fe81937f37 libretro.freeintv: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21 (#364024)
f4d6217435997 pantheon.elementary-terminal: 6.2.0 -> 6.3.0 (#364212)
6aa01d8662aec libretro.fceumm: 0-unstable-2024-09-23 -> 0-unstable-2024-11-23 (#364027)
026a737de16f9 libretro.beetle-wswan: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21 (#364028)
76e1fc9fa1ea3 libretro.genesis-plus-gx: 0-unstable-2024-09-18 -> 0-unstable-2024-11-22 (#364030)
1d365e8d29e4c libretro.o2em: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21 (#364031)
2d7a168aa34c2 libretro.vba-next: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21 (#364033)
0a55764c2eb5f libretro.gambatte: 0-unstable-2024-10-04 -> 0-unstable-2024-11-29 (#364034)
bee404684adef libretro.fmsx: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21 (#364036)
bd2db488d29c1 home-assistant-custom-components.moonraker: 1.4.0 -> 1.5.0
9f2ee84aa8819 libretro.mesen: 0-unstable-2024-06-09 -> 0.9.9-unstable-2024-10-21 (#364038)
93c4dd1a9c019 microfetch: 0.4.1 -> 0.4.2 (#364043)
4f8d72487eede python312Packages.json-repair: 0.30.2 -> 0.30.3 (#364058)
064d1dfa963a0 nats-server: 2.10.22 -> 2.10.23 (#364083)
1182f0c3e2d9a python3Packages.test-results-parser: init at 0.5.1
7422618038aa6 kubescape: 3.0.21 -> 3.0.22 (#364227)
2a720f523f334 dart.file_picker: init (#363407)
c0d72685eea80 libserdes: 7.7.1 -> 7.8.0 (#364189)
502ba9dd0cb8b glaze: 4.0.1 -> 4.0.2 (#364197)
d5f5657db19bc whatsie: Add desktop entry and install icons (#363929)
b4e8b1261881c ocm: 1.0.2 -> 1.0.3 (#364208)
0dd2c6cc48160 twinkle: unstable-2023-03-25 -> unstable-2024-20-11 (#364092)
69c20d9b12342 python312Packages.fints: 4.2.0 -> 4.2.3 (#364106)
24739e5152ba8 python312Packages.gotailwind: 0.2.4 -> 0.3.0 (#364149)
041097c1d1ba7 cpuinfo: 0-unstable-2024-11-14 -> 0-unstable-2024-12-09 (#364154)
fb3ba00373b5d git-worktree-switcher: add mateusauler as co-maintainer (#364236)
6bece76bf935d starpls: 0.1.17 -> 0.1.20 (#364163)
cac2897287deb goread: 1.7.0 -> 1.7.1 (#364166)
3121bc67fd347 python312Packages.pdm-build-locked: 0.3.3 -> 0.3.4 (#364173)
9e708ac6fa247 nomino: 1.3.6 -> 1.3.7 (#364109)
ef78261c29a07 google-java-format: 1.25.0 -> 1.25.1 (#364110)
d2c88d3c5f5ce go-task: 3.40.0 -> 3.40.1 (#364114)
b94f175019924 python312Packages.reptor: 0.24 -> 0.25 (#364122)
864cd89202e1f rqlite: 8.34.1 -> 8.34.3 (#364129)
afb1ff6e4c5dd marwaita-orange: 22 -> 23 (#364139)
da949c1e8f76d flutter_rust_bridge_codegen: 2.6.0 -> 2.7.0 (#364085)
e670df7d61e87 httm: 0.43.2 -> 0.44.0 (#364087)
5d8194e9eb2c4 yubikey-touch-detector: 1.12.0 -> 1.12.2 (#364107)
8cd84794deeea chromium: 131.0.6778.108 -> 131.0.6778.139 (#364063)
b8e0d56349a77 duplicity: 3.0.3.1 -> 3.0.3.2 (#364143)
68936e5e6fdd4 quickgui: remove useless zenity
eb2ed4eb3540b mangayomi: remove useless zenity
2a6c78be41deb fluffychat: remove useless zenity
f746723f331bc flclash: remove useless zenity
0d460350cafd0 cwtch-ui: remove useless zenity
9dc84e1150ed9 dart.file_picker: init
6af66e96a658f mobilizon: 4.1.0 -> 5.1.0 (#363711)
1992eca111a42 gedit: 48.0 → 48.1 (#363201)
045065efb879b kubescape: 3.0.21 -> 3.0.22
e75188aec414f hypnotix: 4.7 -> 4.8 (#364104)
b67a2d717f116 vscode-extensions.ms-toolsai.jupyter: 2024.10.0 -> 2024.11.0
38fec0f0031aa bark-server: 2.1.5 -> 2.1.6 (#364214)
15c97ffcf0a4a nodePackages.vls: drop (#363742)
e4d97f3e704ea jaq: 1.6.0 -> 2.0.1 (#363868)
0b088d4be51dc scdl: 2.12.1 -> 2.12.3 (#363870)
a264d75d5c08f whatsie: Add desktop entry and install icons
f5c1b5b4552e7 python312Packages.chex: 0.1.87 -> 0.1.88
9e717ef9bfda3 cargo-modules: 0.19.1 -> 0.20.2 (#362239)
0e6166eaf82f8 python312Packages.softlayer: fix on darwin
47755f037380d python312Packages.libuuu: fix typo in description
9745ad0a82166 python312Packages.jupysql: 0.10.13 -> 0.10.16
f02e016caa440 python312Packages.prettytable: add GaetanLepage as maintainer
02660f220ba8f python312Packages.prettytable: 3.11.0 -> 3.12.0
3ebe0ca44a688 git-worktree-switcher: add mateusauler as co-maintainer
ac2c2f4cf9e7d maintainers: add mateusauler
144406356a610 versitygw: 1.0.8 -> 1.0.9 (#363805)
a4458d7310b61 sbomnix: 1.7.0 -> 1.7.1
62cbaa39ed9a8 bark-server: 2.1.5 -> 2.1.6
2f610f9856986 nixos/librenms: order librenms-setup after network.target (#363706)
b745cbe1658dc pantheon.elementary-terminal: 6.2.0 -> 6.3.0
f75807ce2a545 ocm: 1.0.2 -> 1.0.3
53261ae0e3a59 batman-adv: 2024.3 -> 2024.4 (#363940)
7d24413fbb330 gitlab: increase node heap size limit (#364187)
44f8ed831b2b8 arrpc: 3.4.0 -> 3.5.0; add systemd user service (#351774)
eafaee722ece9 unbound: support dynlib module (#333301)
ce8a0da4a9c02 legends-of-equestria: init at 2024.05.01 (#296316)
3de5332bba9d9 nixos/qt: install kio when qt.platformTheme = "kde" (#364032)
6c7048f933394 programs/yubikey-touch-detector: add PartOf=graphical-session.target (#364117)
22501447b2e4e glaze: 4.0.1 -> 4.0.2
e2317b109f26f pywal16: 3.7.1 -> 3.7.2
37dc568acd913 ocamlPackages.tls-eio: init at 1.0.4
bfd7154402f88 nixos/ebusd: fix device access (#352743)
2e5a764eaf791  git-worktree-switcher: init at 0.2.4 (#355484)
e9eff47002ddc nixos/networking: don't add extra names to ::1
c1d053679641c libserdes: 7.7.1 -> 7.8.0
4c43880bc847e bitwig-studio: fix MIDI input (#361845)
0c1feac497d4c nixos/ebusd: fix device access
f313eefa97ba4 pywal16: add updateScript
9f4747e9d0ec8 pywal16: add optional-dependencies
3a78dd097dd70 pywal16: add man page
00edd0346e5b9 pywal16: 3.6.0 -> 3.7.1
cb68aacc006d4 gitlab: increase node heap size limit
79a7ad1c21c0c nix: simplify version checks (#363831)
e91d7969aefa0 python312Packages.example-robot-data: 4.1.0 -> 4.2.0 (#363802)
774f764096809 squeezelite: 2.0.0.1504 -> 2.0.0.1507
138ac300dfef4 nixos/v2ray: change the type of `config` field (#163810)
c686ea4e8149b tarlz: 0.25 -> 0.26
e09964d017754 lint-staged: 15.2.10 -> 15.2.11 (#364089)
4350176879088 terraform-providers.ibm: 1.71.2 -> 1.72.1
8c822968ec11d python312Packages.momepy: 0.9.0 -> 0.9.1
da2272328c6eb python312Packages.pdm-build-locked: 0.3.3 -> 0.3.4
d93447f350962 chamber: 3.1.0 -> 3.1.1 (#364076)
223c39872ed28 python312Packages.cymem: 2.0.8 -> 2.0.10
5b5494fe45353 nixos/wireguard-networkd: use systemd credentials for privateKeyFile and presharedKeyFile (#364078)
037efbc6feb40 goread: 1.7.0 -> 1.7.1
0daaba4fbd4e9 malcontent: Add malcontent-ui to passthru.tests
fa5fd554c6edc malcontent: 0.12.0 → 0.13.0
a71752a06d87d starpls: 0.1.17 -> 0.1.20
953f377e926c3 nsd: 4.10.1 -> 4.10.2 (#363428)
c64ac9fb7e1b8 nix-eval-jobs: 2.24.1 -> 2.25.0 (#364137)
65bd49cf93ae7 vimPlugins.blink-cmp: 0.7.3 -> 0.7.6 (#364100)
1634b6e49bb8e python312Packages.gotailwind: 0.2.4 -> 0.3.0
b3438737b4504 python312Packages.mizani: 0.13.0 -> 0.13.1 (#363988)
ca5381c0c6038 netdata: 1.47.4 -> 1.47.5 (#363038)
91aec70f8bb3c python312Packages.msticpy: 2.14.0 -> 2.15.0 (#363889)
cdc04e6c63d75 python312Packages.yte: 1.5.4 -> 1.5.5 (#363891)
600ad84b66ac5 python312Packages.tencentcloud-sdk-python: 3.0.1277 -> 3.0.1278 (#363893)
f16788e76c8c1 python312Packages.groq: init at 0.13.0, python312Packages.speechrecognition: 3.11.0 -> 3.12.0 (#363944)
d536e1e58e6d4 python312Packages.polyswarm-api: 3.10.0 -> 3.11.0 (#363959)
b183f2641c841 python312Packages.pytest-codspeed: 3.0.0 -> 3.1.0 (#363960)
b91c66bf5b415 python312Packages.mypy-boto3-*: updates (#363961)
f6027d6c5f3b2 python312Packages.aioacaia: 0.1.10 -> 0.1.11 (#363982)
2e6322298ad6b python312Packages.plugwise: 1.6.2 -> 1.6.3 (#363966)
960ae2138e41b checkov: 3.2.332 -> 3.2.334 (#363962)
7edbe5289e773 python312Packages.pvo: 2.1.1 -> 2.2.0 (#363958)
ce804b4374f0e python312Packages.sigstore-rekor-types: 0.0.17 -> 0.0.18 (#363983)
3d4d848a208e3 python312Packages.reolink-aio: 0.11.4 -> 0.11.5 (#363984)
b2e5a099a4d43 limine: 8.4.0 -> 8.6.0 (#364103)
de0880c00783f duplicity: 3.0.3.1 -> 3.0.3.2
74dcdfc450cb8 gitlab-ci-local: 4.55.0 -> 4.56.0 (#364134)
2bd5a84b9c993 nixos-option: link to nixos test (#363967)
cb810460f58a8 marwaita-orange: 22 -> 23
6a81d40331e75 cpuinfo: 0-unstable-2024-11-14 -> 0-unstable-2024-12-09
b2bcb86d1b154 nix-eval-jobs: 2.24.1 -> 2.25.0
b03ecbd3514cb ast-grep: 0.30.0 -> 0.31.1 (#364113)
bc08fdc6e5e81 linux-firmware: 20241110 -> 20241210 (#364011)
9b6c95e8e8581 gitlab-ci-local: 4.55.0 -> 4.56.0
9f41b06c81d3f otadump: init at 0.1.2 (#329129)
e866043406b15 terraform-providers.cloudflare: 4.44.0 -> 4.48.0
f6b00e9c88c8e television: 0.5.3 -> 0.6.2 (#364120)
115709cac4bee resources: 1.7.0 -> 1.7.1 (#363218)
f9b3ad9126d37 nbstripout: Don't propagate ipython (#230164)
d87246a418a9a conda: fix aarch64-linux (#363620)
83b3052499b2c config-store: init at 1.0.0 (#363701)
6cec999bb1ca6 pam: Use freebsd.pam on FreeBSD (#362689)
bce6f852d1cda python3Packages.craft-archives: 2.0.0 -> 2.0.2 (#363994)
e4414e862bec3 rqlite: 8.34.1 -> 8.34.3
668076265780c spotdl: 4.2.8 -> 4.2.10 (#361322)
d6af3b31b3da1 spotdl: 4.2.8 -> 4.2.10
1c79dc069afab python312Packages.reptor: 0.24 -> 0.25
2ba85f8268e19 par2cmdline-turbo: 1.1.1 -> 1.2.0 (#363927)
fae5d6025cf7b programs/yubikey-touch-detector: add PartOf=graphical-session.target
2190b2449dfc9 go-task: 3.40.0 -> 3.40.1
12c98df8affee ast-grep: 0.30.0 -> 0.31.1
fd21ef2a65f34 nixos/immich: restrict filesystem permissions
91340b18c1b79 python312Packages.safety: 3.2.9 -> 3.2.11 (#363411)
b5e271018c332 google-java-format: 1.25.0 -> 1.25.1
1035bd8668dee python312Packages.fints: 4.2.0 -> 4.2.3
7a1979d03acc7 nomino: 1.3.6 -> 1.3.7
070b61b84396e yubikey-touch-detector: 1.12.0 -> 1.12.2
24420c3050c53 hypnotix: 4.7 -> 4.8
4b2b10f9208c2 opentelemetry-collector-builder: 0.114.0 -> 0.115.0 (#362698)
9409e7eb50e79 vmware-workstation: fix fhsenv version (#363175)
8b3344d4c46f3 automatic-timezoned: 2.0.38 -> 2.0.40 (#363384)
fa9f99048e8b6 ngtcp2: 1.8.1 -> 1.9.1 (#363446)
cb52981ac0751 limine: 8.4.0 -> 8.6.0
23260ba2b3b3e cava: 0.10.2 -> 0.10.3 (#363506)
4290eadbfbcfa imgpkg: 0.43.1 -> 0.44.0 (#363559)
ccda665bc195c mactracker: init at 7.13 (#363615)
0c0b20d6df641 cynthion: 0.1.7 -> 0.1.8 (#363652)
de03128661296 ocamlPackages.utop: 2.14.0 → 2.15.0
b3a8a4ee4a7ea gollama: 1.27.19 -> 1.28.0 (#363709)
8abe81c57283f tmuxPlugins.session-wizard: 1.3.1 -> 1.4.0 (#363718)
99926bf0606a7 vimPlugins.blink-cmp: 0.7.3 -> 0.7.6
7208217d78324 simplex-chat-desktop: 6.1.1 -> 6.2.0 (#364020)
4d419ea06a94d team-list: establish categorization team (#362938)
1e8e59a902d8d scrcpy: 3.0.2 -> 3.1 (#363786)
4e5a66d5210cb xen: 4.16 is EOL
e812c28e811b5 networkmanager-vpnc: 1.2.8 → 1.4.0
1c58a084ab4e9 Merge inkscape: 1.3.2 -> 1.4 (#348253)
b33f750edba5d twinkle: unstable-2023-03-25 -> unstable-2024-20-11
26baeceed3a5a kora-icon-theme: 1.6.1 -> 1.6.2 (#363744)
579d0cfe8b483 lint-staged: 15.2.10 -> 15.2.11
12e421949ea73 httm: 0.43.2 -> 0.44.0
622f8658b4b52 flutter_rust_bridge_codegen: 2.6.0 -> 2.7.0
caab0be8a3182  freeplane: 1.11.14 -> 1.12.8, use Gradle 8 (#358907)
187adc1516900 nats-server: 2.10.22 -> 2.10.23
0fc40be15941f tenere: init at 0.11.2 (#363556)
45344f2de4dde houdini: fix fhsenv version (#363168)
d9b23fc677211 chamber: 3.1.0 -> 3.1.1
ec329c206b6f2 syshud: 0-unstable-2024-11-12 -> 0-unstable-2024-11-25 (#364066)
648124c83b08b quarto: use pandoc 3.5 (#357687)
90175dd11c930 dotnet: improve EOL evaluation errors (#363439)
b4bf891b00321 buffybox: 3.2.0-unstable-2024-11-10 -> 3.2.0-unstable-2024-12-09 (#363812)
e5a456f26f469 nixos/wireguard-networkd: re-enable by default for networkd users
6bc8dcc6308d3 nixos/wireguard-networkd: use systemd credentials for privateKeyFile and presharedKeyFile
d53b472096788 s7: 11.2-unstable-2024-11-02 -> 11.2-unstable-2024-12-10 (#363882)
6073d7e89b862 chromium: 131.0.6778.108 -> 131.0.6778.139
ac5082f8e44e2 syshud: 0-unstable-2024-11-12 -> 0-unstable-2024-11-25
e8df65937267c dotnet: force evaluation of sdk nuget packages
97a25d0b58eb9 slskd: 0.21.4 -> 0.22.0 (#364051)
ea8474c17e52a electron{-source,-bin,-chromedriver}: updates (#363541)
29bc0f7c74f2e mlkit: 4.7.13 -> 4.7.14 (#363747)
7413ed0368adf inkscape-extensions.inkstitch: init at 3.1.0 (#358993)
027b2935ca165 clapgrep: init at 1.3.1 (#360741)
43a8c56bd21d3 mold: 2.34.1 -> 2.35.0 (#363845)
fee3e54a0c217 python312Packages.json-repair: 0.30.2 -> 0.30.3
cf793a6ae02da bun: 1.1.34 -> 1.1.38 (#360759)
6e56d0b5a92cf ocamlPackages.lacaml: 11.0.10 -> 11.1.0 (#360636)
368ac90b38e44 svg2tikz: mark as broken
5a072ae0ed1f0 inkscape: 1.3.2 -> 1.4
b31ee5c7e268c lib2geom: 1.3 → 1.4
d4b61ee6e351e inkscape: add Luflosi as maintainer
989f87745ba2b inkscape: add x123 as maintainer
2928dcaf2918f inkscape: refactor meta
a1761d91f3b08 ocamlPackages.eliom: 11.0.1 -> 11.1.0 (#360550)
c4dfacc96ca15 nixos/wireguard-networkd: disable by default (#364046)
0b3829a843c89 fluidd: 1.30.5 -> 1.31.0 (#360618)
f03f59d6beee1 libdict: 1.0.3 -> 1.0.4 (#360141)
e521d8dda76c3 steam-rom-manager: 2.5.22 -> 2.5.29 (#360521)
6aaf951519cfb joplin-desktop: 3.0.15 -> 3.1.24 (#360508)
cca305f3e3d03 nixos/wireguard-networkd: fix issue link
0022ce1f3510d emacsPackages.lsp-bridge: 0-unstable-2024-11-14 -> 0-unstable-2024-12-09 (#363970)
a93d42e97e71d nixos/wireguard-networkd: disable by default
14281791dcdf7 OWNERS: add leona to jetbrains (#363973)
d12449d076a3e doc/manpage-urls.json: sort alphabetically (#355678)
da3fc64e1a2b4 microfetch: 0.4.1 -> 0.4.2
654ea97112615 libretro.mesen: 0-unstable-2024-06-09 -> 0.9.9-unstable-2024-10-21
45e926207eafb libretro.fmsx: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21
e7a62c7e0973b libretro.gambatte: 0-unstable-2024-10-04 -> 0-unstable-2024-11-29
de523607dbbbb libretro.vba-next: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21
8783dd8fcf651 libretro.o2em: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21
10a40579bfaa4 libretro.genesis-plus-gx: 0-unstable-2024-09-18 -> 0-unstable-2024-11-22
ee85ee8b83630 doc/README.md: Mention the alphabetical sorting in the documentation
f30fc8c81292b libretro.beetle-wswan: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21
b368da407c7ab doc/manpage-urls.json: sort alphabetically
be0d8d7de047d libretro.fceumm: 0-unstable-2024-09-23 -> 0-unstable-2024-11-23
f425ed85dc5ca tana: 1.0.17 -> 1.0.18 (#363483)
22b87b1b7ee22 nixos/bat: init (#350079)
94f605619bf50 python312Packages.python-linkplay: 0.1.0 -> 0.1.1
f0a2b7b6e271d libretro.freeintv: 0-unstable-2024-06-28 -> 0-unstable-2024-10-21
a59f464331a29 libretro.bluemsx: 0-unstable-2024-10-22 -> 0-unstable-2024-12-04
ad12b2652627a nixos/crab-hole: init (#341598)
e6c72076b497a rockcraft: add tabulate to check inputs
778e494d9eb13 python3Packages.craft-parts: 2.1.3 -> 2.1.4
800a740ea8437 python3Packages.craft-archives: 2.0.0 -> 2.0.2
f5e50b74a0d79 treewide: rename python3Packages.debian -> python3Packages.python-debian
bd4a6b9aaec42 nixos/crab-hole: init crab-hole
a50c9800bc775 crab-hole: init at 0.1.10
7c314adf551c3 libvarlink: 23 -> 24 (#363979)
f08f60b8bcddf pkcs11-provider: 0.5 -> 0.6 (#362992)
b5f1e7667d649 simplex-chat-desktop: 6.1.1 -> 6.2.0
79eac16fdad3c moodle: 4.4.3 -> 4.4.4 (#360394)
07a190e7a44fb datalad: fix changed hash from upstream
11c34f6d2cf9c libretro.nestopia: 0-unstable-2024-10-17 -> 0-unstable-2024-12-10
989acfe3c390f Treewide Nix reformat pass 1 [skip treewide] (#322537)
bb8192d2b7233 .git-blame-ignore-revs: Add treewide reformat pass 1 for master,staging{,-next}
4f0dadbf38ee4 treewide: format all inactive Nix files
75d54b468a2a5 renovate: 38.105.2 -> 39.42.4 (#361090)
0850df266a45f maintainers: add NiklasVousten
b32a0943687d2 vimPlugins.avante-nvim: move out to separate directory (#364001)
3887116c00ea3 linux-firmware: 20241110 -> 20241210
5fb01cdab19ba flood: 4.8.2 -> 4.8.5
2440ed4019528 vimPlugins.avante-nvim: move out to separate directory
b93b330c2927f ocamlPackages.mdx: 2.4.1 → 2.5.0 (#363210)
037038b161ce1 ocamlPackages.mirage-crypto-rng-eio: init at 1.1.0 (#362377)
a0f3c68ab093e zf: format, update (#349644)
68cf0d86c9dde python312Packages.pysvn: 1.9.22 -> 1.9.23 (#363066)
15d88de94d0ff pdfium-binaries: 6872 -> 6886 (#363996)
9bdb97c052d5d otadump: init at 0.1.2
9ad61cfc19c1f nixos/plymouth: add support for logo in catppuccin (two-step) theme (#304045)
cdd6827c93c09 pdfium-binaries: 6872 -> 6886
3a068accfd4b4 nixos/bat: init bat module
3e3caa5f733ca python312Packages.mizani: 0.13.0 -> 0.13.1
66676a8096a25 ipxe: 1.21.1-unstable-2024-09-27 -> 1.21.1-unstable-2024-12-03 (#363976)
adb0e106b54f5 libvmi: 0.14.0-unstable-2024-09-18 -> 0.14.0-unstable-2024-11-06 (#363436)
02db5ff29455c python312Packages.aioacaia: 0.1.10 -> 0.1.11
7e4fef772d1a5 python312Packages.sigstore-rekor-types: 0.0.17 -> 0.0.18
d6e107169b795 ArchiSteamFarm: 6.0.8.7 -> 6.1.0.3 (#361305)
38eff9f4677ea python312Packages.reolink-aio: 0.11.4 -> 0.11.5
63a21b156fe49 sonarr: 4.0.10.2544 -> 4.0.11.2680 (#362549)
b3392e73a0e5c renovate: 38.105.2 -> 39.42.4
9a33d3639d795 libvarlink: 23 -> 24
de18c74d31da8 opencomposite: 0-unstable-2024-10-28 -> 0-unstable-2024-11-11 (#363875)
dea044a1ef94f Firefox: 133.0 -> 133.0.3; 128.5.0esr -> 128.5.1esr (#363898)
2e6d5d71fe89b crates-tui: 0.1.22 -> 0.1.23 (#363892)
6bb50c992f7a0 OWNERS: add leona to jetbrains
dc797c902e035 jetbrains.plugins: fix adding JAR plugins (#321247)
9c8b1be6ecd49 emacsPackages.lsp-bridge: 0-unstable-2024-11-14 -> 0-unstable-2024-12-09
1caf076d6ba46 osu-lazer: add native Wayland option (#363908)
e4206aafdd899 nixos-option: link to nixos test
55812b8325dd8 ipxe: 1.21.1-unstable-2024-09-27 -> 1.21.1-unstable-2024-12-03
f6296711744ed polarity: 0-unstable-2024-11-15 -> latest-unstable-2024-12-09 (#363810)
fa559bd56293c redis - complete lib refactor (#363775)
f6f3c4e74c61b python312Packages.plugwise: 1.6.2 -> 1.6.3
bbfaa21171ff2 checkov: 3.2.332 -> 3.2.334
f4e95c30fee74 python312Packages.mypy-boto3-workspaces: 1.35.68 -> 1.35.77
10e041b63ae2e python312Packages.mypy-boto3-medialive: 1.35.23 -> 1.35.77
3099086d96332 python312Packages.mypy-boto3-keyspaces: 1.35.65 -> 1.35.77
a6f1472f3eb05 python312Packages.mypy-boto3-ecs: 1.35.72 -> 1.35.77
e333ea0d3f485 python312Packages.mypy-boto3-ec2: 1.35.72 -> 1.35.77
72448bb723181 python312Packages.mypy-boto3-cognito-idp: 1.35.68 -> 1.35.77
9c6fb1cf3a140 python312Packages.mypy-boto3-appsync: 1.35.67 -> 1.35.77
00383674bd2b8 python312Packages.pytest-codspeed: 3.0.0 -> 3.1.0
c4329f867fd95 python312Packages.pvo: refactor
ffe0849a4ac73 python312Packages.pvo: 2.1.1 -> 2.2.0
f958d5c5f9b88 python312Packages.polyswarm-api: 3.10.0 -> 3.11.0
0ca9593b2dc19 lutris: fix Dolphin and RPCS3 AppImage; add rapiteanu to maintainer list (#350535)
4b4de2752fe81 python312Packages.python-openstackclient: add requests socks support (#363651)
95a592d949e80 lutris: 0.5.17 -> 0.5.18 (#361017)
f74bd181b828c gedit: 48.0 → 48.1
a5d767c91d7b7 dotnet/combine-packages: don't inherit meta from cli
6e180e8e5c890 dotnet/wrapper: don't inherit meta from unwrapped
512ea5388a0a5 nexusmods-app: fix passthru tests (#354018)
95776b6965827 python312Packages.speechrecognition: 3.11.0 -> 3.12.0
5ed339ff57695 python312Packages.groq: init at 0.13.0
389452a51679a Merge: nextcloud29: 29.0.9 -> 29.0.10, update apps (#363232)
31bfd9cc45758 fiji: add wrapGAppsHook (#363577)
38c02e8952338 batman-adv: 2024.3 -> 2024.4
2bd2fb9385031 kotlin-native: 1.9.23 -> 1.9.24 (#309852)
c44b4dac61951 reindeer: 2024.10.28.00 -> 2024.12.09.00 (#363848)
60aa974e92754 python312Packages.pyecharts: 2.0.6 -> 2.0.7 (#363900)
514819a5a4e18 amber-secret: 0.1.6 -> 0.1.7 (#363905)
7d6f16bf6f3a4 myks: 4.2.4 -> 4.2.5 (#363925)
6d78a7d119caf hpp2plantuml: 0.8.5 -> 0.8.6 (#363931)
fde11b1cf319a ldeep: 1.0.76 -> 1.0.77 (#363785)
3a05e34d31285 sd-local: 1.0.55 -> 1.0.56 (#363803)
632e2ce975fde librime-octagram: 0-unstable-2024-02-05 -> 0-unstable-2024-11-18 (#363830)
d1c4cec15ddd3 fmtoy: 0-unstable-2024-06-11 -> 0-unstable-2024-11-13 (#363833)
c1a7bb35bdb93 ironicclient: 5.8.0 -> 5.9.0 (#363857)
3a00cc2aec2f8 manilaclient: 5.0.0 -> 5.1.0 (#363856)
d1d71fbf93ece cht-sh: 0-unstable-2022-04-18 -> 0-unstable-2024-11-13 (#363837)
e111a62f12179 granted: 0.36.3 -> 0.37.0 (#363838)
1ce183eb09238 supabase-cli: 2.0.0 -> 2.0.6 (#363843)
e23c0a74b27eb git-chain: 0-unstable-2024-08-09 -> 0-unstable-2024-11-16 (#363846)
25be2793eb6ed goimports-reviser: 3.7.4 -> 3.8.2 (#363674)
74adff8ef43f3 blasfeo: 0.1.4 -> 0.1.4.1 (#363678)
044895d6f437e python312Packages.oci: 2.135.1 -> 2.139.0 (#363687)
51da351a339c9 havn: 0.1.16 -> 0.1.17 (#363688)
00b7e44cc478d cargo-binstall: 1.10.13 -> 1.10.16 (#363692)
8e926768c008d harsh: 0.10.4 -> 0.10.6 (#363698)
56369869fb9c6 python312Packages.nbdev: 2.3.32 -> 2.3.34 (#363717)
995e3eeda3e1b tideways-daemon: 1.9.22 -> 1.9.28 (#363728)
779f79a8a7329 seilfahrt: 2.1.0 -> 2.1.1 (#363743)
aa67c6dc1e3d7 inv-sig-helper: 0-unstable-2024-09-24 -> 0-unstable-2024-12-10 (#363858)
be7b77d262408 troubadix: 24.10.2 -> 24.11.0 (#363752)
46bef816700e1 gfold: 4.5.0 -> 4.5.1 (#363772)
b15a5903efc65 rednotebook: 2.35 -> 2.36 (#363576)
394b3af0f2a67 prometheus-pve-exporter: 3.4.5 -> 3.4.6 (#363580)
cd311045fb38e minigalaxy: 1.3.0 -> 1.3.1 (#363586)
9ac65ad814f5d stylua: 2.0.1 -> 2.0.2 (#363591)
67c3715efc87b k8sgpt: 0.3.46 -> 0.3.48 (#363594)
dcec25d700a2e steampipePackages.steampipe-plugin-aws: 1.3.0 -> 1.4.0 (#363606)
0f94350e2bf36 vendir: 0.42.0 -> 0.43.0 (#363613)
faf4d1624dd0f marcel: 0.30.1 -> 0.30.4 (#363624)
115f8bf36d640 elements: 23.2.1 -> 23.2.4
f638cca879d81 libretro.mrboom: 0-unstable-2024-07-01 -> 5.5-unstable-2024-10-21 (#363627)
1302d38697899 libretro.snes9x: 0-unstable-2024-10-28 -> 1.63-unstable-2024-12-08 (#363630)
21c3faa7b7e89 ttdl: 4.5.0 -> 4.7.0 (#363631)
23796a7fa03c4 libretro.stella: 0-unstable-2024-11-17 -> 7.0-unstable-2024-12-09 (#363635)
47fea594d602b doppler: 3.69.2 -> 3.70.0 (#363641)
171b17877c6bd powerpipe: 1.0.0 -> 1.0.1 (#363673)
4a6cfdf711eb7 osu-lazer{,-bin}: add native Wayland option
fe78af832d7d2 gnome-extensions-cli: 0.10.3 -> 0.10.4 (#363477)
93222392c51e0 hpp2plantuml: 0.8.5 -> 0.8.6
f7c5e2d38d933 xemu: 0.7.133 -> 0.7.134 (#363488)
45eb78f2e71a6 minify: 2.21.1 -> 2.21.2 (#363495)
02c7d1852dd1a abctl: 0.22.0 -> 0.23.0 (#363502)
4b772864b2abe python312Packages.pytest-examples: 0.0.14 -> 0.0.15 (#363515)
a68d6ce6f58ca python312Packages.pyomo: 6.8.1 -> 6.8.2 (#363516)
84cc66198e2ac kor: 0.5.6 -> 0.5.7 (#363921)
776c1a01e5aba python312Packages.pytelegrambotapi: 4.24.0 -> 4.25.0 (#363517)
2150053cd700f jbang: 0.120.4 -> 0.121.0 (#363520)
cdb5bd9f4fe06 files-cli: 2.13.180 -> 2.13.202 (#363527)
47ad8bd36a427 pulsarctl: 4.0.0.4 -> 4.0.0.8 (#363534)
2c816dd720a52 steampipe: 1.0.0 -> 1.0.1 (#363542)
03dd6d8714a73 cowsay: 3.8.3 -> 3.8.4 (#363543)
ba46e8d656b04 tile38: 1.33.4 -> 1.34.0 (#363806)
c41eb63ffb4b6 mmv: 2.8 -> 2.10 (#363551)
b36e3495b2d6c python312Packages.xonsh: 0.18.4 -> 0.19.0 (#363608)
ed151d25a0292 par2cmdline-turbo: 1.1.1 -> 1.2.0
4d60723b1f1fe clickhouse-backup: 2.6.3 -> 2.6.4 (#363564)
1ebbcd51220e6 okteto: 3.1.0 -> 3.2.0 (#363582)
16725a4368956 myks: 4.2.4 -> 4.2.5
d15e9b6a35cb9 Revert "nixos-option: cleanup and linting" (#363919)
ba8c043270af5 Revert "nixos-option: cleanup and linting"
2eccf3129ce1d kryptor: .NET 6 -> 8 (#363629)
0101e48c8f2e2 home-assistant-custom-lovelace-modules.sankey-chart: 3.5.0 -> 3.6.0 (#363916)
58c2c34d575c4 kor: 0.5.6 -> 0.5.7
df8e6f7487dff system/activation: mention deps attr in activationScripts example
4b45fe7c20bd4 jaq: 1.6.0 -> 2.0.1
f23d497010306 watchlog: 1.240.0 -> 1.242.0 (#363907)
e37753fdff03b exo: 0-unstable-2024-11-30 -> 0-unstable-2024-12-07 (#363899)
508da8da374c5 devbox: 0.13.6 -> 0.13.7 (#362642)
f67f8eef13f19 fiji: add wrapGAppsHook
4cbd64d0a6ae4 watchlog: 1.240.0 -> 1.242.0
7d3031758357c amber-secret: 0.1.6 -> 0.1.7
0acd6eb6eec33 Enable HDMI out on platforms using the RK3588 lineup of SoCs. (#363886)
0e8be3827d029 ghidra-extensions.findcrypt: 3.0.2 -> 3.0.3 (#363311)
3dc6caab6c00a wireshark: fix build on darwin (#363544)
411acbe5313d9 runescape: fix fhsenv version (#363179)
9d71611c9fc0a firefox-esr-128-unwrapped: 128.5.0esr -> 128.5.1esr
6c7a4c00693a1 firefox-bin-unwrapped: 133.0 -> 133.0.3
b0d27dc7ffebf firefox-unwrapped: 133.0 -> 133.0.3
43c18a13d3a0f python312Packages.pyecharts: 2.0.6 -> 2.0.7
0d6402bcf381f emulationstation-de: 3.0.2 -> 3.1.0 (#361774)
480908f538c64 exo: 0-unstable-2024-11-30 -> 0-unstable-2024-12-07
0b9587a2cabde chance: 4.0.0 -> 4.0.1 (#363827)
d1b730bae1131 discord: update stable and canary (#363874)
56dc1ca1ac4b0 scooter: 0.1.2 -> 0.2.1 (#363590)
523c8dc3f3a7e netbird-ui: 0.33.0 -> 0.34.1 (#363358)
5009729244e0b sftpgo: 2.6.3 -> 2.6.4 (#363513)
a89ad69cd90cf python312Packages.yte: 1.5.4 -> 1.5.5
dd4e8f555eee7 python312Packages.tencentcloud-sdk-python: 3.0.1277 -> 3.0.1278
de962b9056d69 python312Packages.nimfa: fix build (#363065)
acaee51228277 nixos/redmine: Change type of services.redmine.stateDir to `path` (#363430)
5c30302cfcb44 flameshot: 12.1.0-unstable-2024-09-01 -> 12.1.0-unstable-2024-12-03 (#362828)
861ea51edd978 crates-tui: 0.1.22 -> 0.1.23
5a64b8dff9026 flutter_rust_bridge_codegen: init a 2.6.0 (#356576)
4e3c8d646ab35 cargo-temp: 0.2.22 -> 0.3.0 (#362635)
b98522bc0f0e2 amdgpu_top: 0.9.2 -> 0.10.0 (#363569)
f891215fb0c82 cri-tools: 1.31.1 -> 1.32.0 (#363561)
8a2b5358bec7c sqlite-vec: 0.1.5 -> 0.1.6 (#363518)
92365df4b4419 stm32cubemx: 6.12.1 -> 6.13.0 (#363379)
55c720adb5244 picocrypt: 1.44 -> 1.45 (#363345)
7243daf549a0b qtscrcpy: 3.0.0 -> 3.0.1 (#363525)
bf02ddbadb893 pkgsite: 0-unstable-2024-12-06 -> 0-unstable-2024-12-09 (#363811)
dab510a2909f9 python3Packages.zenoh: init at 1.0.3 (#361227)
d150e2b28470e Enable HDMI out on platforms using the RK3588 lineup of SoCs.
45135b31a8782 json-schema-for-humans: fix build and update (#362898)
ff6ad0470c31d git-repo: 2.48 -> 2.49.3 (#363817)
56e36e8d5763d python312Packages.msticpy: 2.14.0 -> 2.15.0
f79961ac201f4 python312Packages.django-q: use build-system/dependencies, correct us… (#363734)
2e1411dc2f28a s7: 11.2-unstable-2024-11-02 -> 11.2-unstable-2024-12-10
c12fdf4746f54 python312Packages.multiscale-spatial-image: 2.0.1 -> 2.0.2 (#363271)
3cb8d7cfd6e53 tela-circle-icon-theme: 2024-04-19 -> 2024-11-15 (#363465)
0091ba1a83a42 python312Packages.qbittorrent-api: 2024.10.68 -> 2024.11.70 (#363260)
efa8363cad3e5 fabric-ai: 1.4.99 -> 1.4.119 (#363401)
15e41f94ceadd clash-meta: 1.18.10 -> 1.19.0 (#363558)
0693a1e00163d codeql: 2.19.3 -> 2.19.4 (#363359)
5ae4a39e9b829 databricks-cli: 0.234.0 -> 0.236.0 (#363361)
9a84ebcd08a7e alacritty-theme: 0-unstable-2024-10-24 -> 0-unstable-2024-12-02 (#363840)
e5b42a5443632 flclash: 0.8.69 -> 0.8.70 (#363383)
18fdf41fdc89f wasm-tools: 1.221.0 -> 1.221.2 (#363406)
f7640ef9c75b0 carapace: 1.0.7 -> 1.1.0 (#363422)
e683434394b20 qownnotes: 24.11.2 -> 24.12.1 (#363445)
865ea49927b84 python312Packages.nicegui: init at 2.5.0 (#352189)
1553bb3adb54e python312Packages.pymodbus: 3.7.4 -> 3.8.0 (#363570)
26446c6ba6168 python312Packages.withings-sync: 4.2.6 -> 4.2.7 (#363571)
e5a3c6dcb9b53 python312Packages.pymiele: 0.1.7 -> 0.2.0 (#363592)
84acc9d36b0c9 python312Packages.django-filer: 3.3.0 -> 3.3.1 (#363715)
3b18c78ffee0a badger: 4.4.0 -> 4.5.0 (#363703)
cc85c95c0d0c7 discord-canary: 0.0.535 -> 0.0.538
ac44b8c010d08 discord: 0.0.76 -> 0.0.77
a22cbab59462f deepin.dde-gsettings-schemas: remove deepin-movie-reborn (#363860)
fe8846dad6e2c opencomposite: 0-unstable-2024-10-28 -> 0-unstable-2024-11-11
cf2843b6fb79f pkgsCross.x86_64-darwin.discord-canary: 0.0.647 -> 0.0.650
763b0b6d5e257 pkgsCross.x86_64-darwin.discord: 0.0.328 -> 0.0.329
d10eccec9d957 Kernel updates for 2024-12-09 (#363839)
93ae5fa190e63 lutris: add rapiteanu to maintainer list
0901bc2b615f4 jaq: format
7861ca184d5c7 scdl: 2.12.1 -> 2.12.3
592b1a2de0e84 python3Packages.django-mfa3: Enable failing test (#362537)
f892b96d80bbd platformsh: 5.0.22 -> 5.0.23 (#363654)
cd0c9867dee60 upsun: 5.0.22 -> 5.0.23 (#363657)
dbf9816617347 deepin.dde-gsettings-schemas: remove deepin-movie-reborn
9453e4f68aa4e inv-sig-helper: 0-unstable-2024-09-24 -> 0-unstable-2024-12-10
b9cbab7e1bca2 ollama: 0.5.0 -> 0.5.1 (#363714)
22b2472342bf4 healthchecks: 3.7 -> 3.8 (#363794)
1426c5148bc7b c3-lsp: 0.3.2 -> 0.3.3 (#363557)
5fdc96526d28a ironicclient: 5.8.0 -> 5.9.0
50399d19602e7 vcpkg: 2024.10.21 -> 2024.11.16 (#363143)
24d9cb7296959 lutris: fix Dolphin
5dc20e9ede900 lutris: fix RPCS3 AppImage
ec121df92aa4e ci/eval: fix compare label assignment (#363851)
e6b1c33d5ca94 manilaclient: 5.0.0 -> 5.1.0
214cb79aa634a ci/eval: fix compare label assignment
eaae2eaec74b7 subversion: 1.14.4 -> 1.14.5 (#363461)
2e0d3d902efde kgeotag: 1.6.0 -> 1.7.0 (#363769)
000c7bc616d53 audiobookshelf: 2.17.4 -> 2.17.5 (#363437)
feb8a718f6c43 reindeer: 2024.10.28.00 -> 2024.12.09.00
db823200e66aa vimPlugins: update on 2024-12-09 (#363741)
7769e0dba9dd6 python312Packages.llama-cpp-python: 0.3.1 -> 0.3.2 (#363339)
0d4ea96a076dc sccache: 0.8.2 -> 0.9.0 (#363771)
6b8864a8ce783 meli: 0.8.9 -> 0.8.10 (#363721)
e026c552a37b3 cargo-about: 0.6.5 -> 0.6.6 (#363647)
e7ce8cf7eb61b git-chain: 0-unstable-2024-08-09 -> 0-unstable-2024-11-16
147930bc02be5 python312Packages.llama-cpp-python: mark as broken on darwin
ecc1ae01a415b python312Packages.llama-cpp-python: 0.3.1 -> 0.3.2
80643438112fa python312Packages.langgraph*: 20241206 update (#362648)
bb23268100aeb supabase-cli: 2.0.0 -> 2.0.6
be9283e000374 rye: 0.42.0 -> 0.43.0 (#363798)
ee1abbbe5daaf lite-xl: update to version 2.1.7 (#362925)
f49af0734f64d rye: 0.42.0 -> 0.43.0
2470715779d49 alacritty-theme: 0-unstable-2024-10-24 -> 0-unstable-2024-12-02
d76dafcd29ff6 linux_6_6: 6.6.63 -> 6.6.64
2bb25ed39c775 linux_6_12: 6.12.3 -> 6.12.4
51a19038a275b linux_testing: 6.13-rc1 -> 6.13-rc2
cd34221a4b06d emiluaPlugins.this-thread: 1.0.0 -> 1.0.1 (#363051)
27d9c1fd5c4c5 shntool: 3.0.10 -> 3.0.10+git20130108.4ca41f4-1 (#357635)
134181477807f gamescope: 3.15.14 -> 3.15.15 (#363795)
2f8e672b3d292 granted: 0.36.3 -> 0.37.0
09beb24a34375 cht-sh: 0-unstable-2022-04-18 -> 0-unstable-2024-11-13
940f8001641b2 kanidm: fix 1.3 build and permit hydra to build it (#363662)
a7aedc9802c07 fmtoy: 0-unstable-2024-06-11 -> 0-unstable-2024-11-13
90f44b313c7a9 nix: remove fixed CVE-2024-27297 check
0e59e7b7d81cc nix: simplify version checks
9e46b6e6e0b49 meteor-git: 0.23.1 -> 0.24.2 (#363782)
8eafe1f165e5b perkeep: 0.11 -> 0-unstable-2024-04-23 (#360175)
68327e14007c1 librime-octagram: 0-unstable-2024-02-05 -> 0-unstable-2024-11-18
c146818be28be nixos/services.redis: complete removal of with lib;
09f15588e4579 chance: 4.0.0 -> 4.0.1
2766b6227a139 ocm: 0.1.73 -> 1.0.2 (#361805)
3122317c2c36a liblouis: 3.31.0 -> 3.32.0
b53f626e0cc74 jenkins: 2.462.3 -> 2.479.2 (#360869)
0675118dbf11e lowdown: 1.2.0 -> 1.3.1 (#360988)
a42171f34dc72 ethercat: 1.6.1 -> 1.6.2 (#363796)
5a4fbaa3290ec beeper: 3.109.1 -> 3.110.1 (#361944)
daba6752a280f nebula: 1.9.4 -> 1.9.5 (#362508)
631ac8b6b44d1 python312Packages.ibis-framework: add missing `packaging` dep to duckdb optional-dependencies (#348856)
1d6ac44414666 lean4: 4.10.0 -> 4.11.0 (#354669)
e7cc50236e543 application-title-bar: 0.7.5 -> 0.7.7 (#363774)
8300b2bc9f1e8 github-backup: 0.46.0 -> 0.47.0 (#363784)
7e2b9bfc30beb telegraf: 1.32.3 -> 1.33.0 (#363788)
7abfc580ba2ad git-repo: 2.48 -> 2.49.3
d00f5020b0078 keycloak: 26.0.6 -> 26.0.7 (#361443)
a991bdc4640e5 telegram-desktop: 5.8.2 -> 5.9.0 (#361785)
43785144de5a6 perlPackages.FinanceQuote: 1.63 -> 1.64
81bf92cde1400 v2ray-domain-list-community: 20241112092643 -> 20241210004721 (#363808)
6293cdcc01f92 python312Packages.ocrmypdf: 16.6.2 -> 16.7.0 (#363685)
41a475a07bc69 buffybox: 3.2.0-unstable-2024-11-10 -> 3.2.0-unstable-2024-12-09
203236d4998c7 pkgsite: 0-unstable-2024-12-06 -> 0-unstable-2024-12-09
33a6a79a8da12 polarity: 0-unstable-2024-11-15 -> latest-unstable-2024-12-09
8ba56520bbe36 genemichaels: 0.1.21 -> 0.5.7 (#363473)
dda087e1594fa calibre: add image optimization programs (#362822)
e2f4abd96cf82 sequin: 0.2.0 -> 0.3.0 (#363764)
fc5e9aa247e32 pulumi-esc: 0.11.0 -> 0.11.1 (#362417)
1920452caaa73 hunspellDicts.et_EE: init at 20030606 (#307820)
fe540afbe258c gnome-secrets: 9.6 -> 10.3 (#356025)
9bad60f0cc1a9 linux-wallpaperengine: fix zygote could not fork error (#362774)
0779f3345bfaa git-town: 16.4.1 -> 16.7.0 (#362522)
cd57074bf3e57 python312Packages.flake8-bugbear: 24.8.19 -> 24.10.31 (#363062)
add2939485319 atac: 0.18.0 -> 0.18.1 (#362862)
1ea7633847efc nixos-option: cleanup and linting (#355748)
634ffca706c27 buf: 1.47.0 -> 1.47.2 (#363448)
b019e5868391c ginkgo: 2.21.0 -> 2.22.0 (#362969)
4019f043e81b5 calls: 46.3 -> 47.0 (#363157)
9f9cacfac9e49 marktext: build from source (#354253)
20d4125ac010d cirrus-cli: 0.133.0 -> 0.133.2 (#363702)
61da46c26431d chiaki-ng: 1.9.1 -> 1.9.2 (#363120)
31cada6f7d6bb xpipe: 13.2 -> 13.4.3 (#363309)
36976ac398b60 cri-o-unwrapped: 1.31.2 -> 1.31.3 (#363121)
a424d075fb3d2 changedetection-io: 0.47.06 -> 0.48.01 (#362824)
28a1c68285f1f gvproxy: 0.8.0 -> 0.8.1 (#362475)
afb5947eed0bd fastly: 10.17.0 -> 10.17.1 (#363403)
d630a1721df29 python312Packages.cashews: 7.3.1 -> 7.4.0 (#360679)
1b37580c708aa simdjson: 3.10.1 -> 3.11.0 (#362398)
ce3ae1e3cf149 cloudflare-dynamic-dns: 4.3.9 -> 4.3.11 (#363363)
4cb54ba6f1f44 deja-dup: 46.1 -> 47.0 (#362053)
b3832ef1b4219 gobgpd: 3.30.0 -> 3.32.0 (#363250)
d251b7907899e gobgp: 3.30.0 -> 3.32.0 (#363249)
2fbb4a456d3b2 v2ray-domain-list-community: 20241112092643 -> 20241210004721
4b5728a2aae73 katana: 1.1.1 -> 1.1.2 (#363727)
3f21cf55338d1 tile38: 1.33.4 -> 1.34.0
78ba8eabb4b52 python312Packages.example-robot-data: 4.1.0 -> 4.2.0
917ed0b6d7d22 versitygw: 1.0.8 -> 1.0.9
a6595a5ab8d82 sd-local: 1.0.55 -> 1.0.56
5b4eab908b5c6 htmldoc: 1.9.19 -> 1.9.20 (#363737)
af682f39a7dd6 team-list: establish categorization team
81e3b54e57e08 wcurl: 2024.07.10 -> 2024.12.08 (#363562)
a8e51aa44ef06 ethercat: 1.6.1 -> 1.6.2
76a84ecc52b3c gamescope: 3.15.14 -> 3.15.15
2e28f1f82e1ff healthchecks: 3.7 -> 3.8
b15b219eefabd Thunderbird: 132.0.1 -> 133.0; 128.4.3esr -> 128.5.1esr (#363773)
a6433e9db82ae ktor-cli: 0.3.0 -> 0.3.1 (#363478)
3318aa52de01f nixos/git-worktree-switcher: init git-worktree-switcher
da5e1da65bf6d terraform-providers.azurerm: 4.10.0 -> 4.13.0
e797337fb5a7e terraform-providers.kubernetes: 2.33.0 -> 2.34.0
1f09e31ceb0a8 terraform-providers.selectel: 5.4.0 -> 6.0.1
10dd39aba95fd terraform-providers.avi: 22.1.6 -> 30.2.2
83da268002504 wechat-uos: fix fhsenv version (#363162)
3477e197381e8 scrcpy: 3.0.2 -> 3.1
17121bf6202f7 git-worktree-switcher: init at 0.2.4
2ef9c503d7530 ldeep: 1.0.76 -> 1.0.77
72c51d51f42a0 github-backup: 0.46.0 -> 0.47.0
a9d363679d977 telegraf: 1.32.3 -> 1.33.0
bb0a53c74e7b3 langgraph*: use `tag` option to `fetchFromGitHub`
d0214f2bd7e30 meteor-git: 0.23.1 -> 0.24.2
105e61ab03958 langgraph-checkpoint-*: Relax dependency on langgraph-checkpoint
3535716d80664 python3Packages.langgraph-checkpoint-postgres: 2.0.2 -> 2.0.8
2f0cfddd95344 python3Packages.langgraph-checkpoint: 2.0.2 -> 2.0.8
63553f304931e python3Packages.langgraph-sdk: 0.1.35 -> 0.1.43
a15abb34628a8 python3Packages.langgraph: 0.2.43 -> 0.2.56
4b873163c34e9 marwaita-red: 22.2 -> 23 (#363251)
6b06df4137cb6 marwaita-yellow: 20.3.1 -> 23 (#363244)
795fc742f5202 screego: 1.11.1 -> 1.11.2 (#363603)
e2c6430a396d4 thunderbird-128-unwrapped: 128.4.3esr -> 128.5.1esr
b5b6587eae9dd thunderbird-latest-unwrapped: 132.0.1 -> 133.0
7d196fbefee0e python312Packages.albumentations: 1.4.20 -> 1.4.22 (#363443)
a8e8e5a27493d gfold: 4.5.0 -> 4.5.1
cb8d9080d9922 sccache: 0.8.2 -> 0.9.0
fa2fcb868f909 kgeotag: 1.6.0 -> 1.7.0
ae2e628089449 sequin: 0.2.0 -> 0.3.0
2f3930f291dca {ares,bsnes-hd,higan}: update (#353102)
0311f6c40e0a7 treewide/nixos: remove `with lib;` part 5 (#335647)
47f1ce82e5d33 bird: 2.15.1 -> 2.16 (#362997)
e7b93f44dcf60 kryptor: add maintainer gepbird
1f93aee30f4d5 kryptor: add version checking
2d8de12e2d4c1 kryptor: add update script
013e057567518 ktailctl: 0.18.1 -> 0.18.2 (#363671)
a4e756888c3b8 nixos/mailman: increase uwsgi buffer size (#359037)
248081c472925 nixos/caddy: add environmentFile option (#363694)
9268e3f2c337a freefilesync: 13.8 -> 13.9 (#363726)
daa80365f5a8b cunicu: 0.5.53 -> 0.5.65 (#363605)
756a7e1169404 tinty: init at 0.23.0 (#363568)
d298ddec02bad github-runner: use finalAttrs to make it possible to override the version (#363733)
128bd7f9742a0 equicord: 1.10.6 -> 1.10.8 (#363462)
ecaa6df0629c1 higan: 115-unstable-2024-02-17 -> 115-unstable-2024-09-04
ef169558cd630 higan: refactor
6a1c2b2dbac42 higan: remove darwin references
e9a373340f92c bsnes-hd: 10.6-beta -> 10.6-unstable-2024-10-21
3a9d7f9567c73 bsnes-hd: refactor
f5820ce82761b bsnes-hd: migrate to by-name
700f9e5039cf0 bsnes-hd: use `apple-sdk_11`
7448a92e30795 ares: refactor
5e67300be4238 ares: migrate to by-name
aa5eac62ca2a1 ares: use `apple-sdk_11`
6b37f91a864cc python312Packages.pyexploitdb: 0.2.57 -> 0.2.58 (#363567)
07b609f199aad python312Packages.tencentcloud-sdk-python: 3.0.1275 -> 3.0.1277 (#363579)
ecf020711c52a python312Packages.dirigera: 1.2.1 -> 1.2.2 (#363583)
0425490f47788 python312Packages.asyncinotify: 4.1.0 -> 4.2.0 (#363584)
c8f9310748d5d troubadix: 24.10.2 -> 24.11.0
314edfd2d5dcc ankama-launcher: 3.12.26 -> 3.12.27 (#363713)
5d11e4f62a7e5 matomo_5: 5.1.1 -> 5.1.2 (#363621)
d34a8ecc24aab mlkit: 4.7.13 -> 4.7.14
6e984ab74f3a5 python312Packages.minari: 0.5.1 -> 0.5.2 (#363623)
79279db44aa49 rust-analyzer-unwrapped: 2024-11-11 -> 2024-12-02 (#363416)
fd12a39f61f72 kora-icon-theme: 1.6.1 -> 1.6.2
b390877d279c4 vimPlugins.nvim-treesitter: update grammars
c51b5d62cdb45 vimPlugins: update on 2024-12-09
10e95f3d0ae85 nodePackages.vls: drop
033d2e3a6a0a6 freeplane: use Gradle 8
15a83f8b26aed freeplane: 1.11.14 -> 1.12.8
27415e8e9c68e seilfahrt: 2.1.0 -> 2.1.1
1434a1b1d4f9b ldapnomnom: 1.4.1 -> 1.5.1 (#363033)
52cca64c3cdc0 nginxMainline: 1.27.2 -> 1.27.3 (#360056)
d2652e05e9bc1 octoscan: 0.1.2 -> 0.1.3 (#362857)
c17b4733f4cef python312Packages.django-q: use build-system/dependencies, correct used build-system
46ba3763bb1e2 chezmoi: 2.53.1 -> 2.55.0 (#363099)
d1b054a1ae40a lefthook: 1.8.1 -> 1.9.0 (#362684)
fcccacf7c8d21 Merge gnomeExtensions: auto-update (#361400)
bde7bfa9915d5 brave: 1.73.91 -> 1.73.97 (#363052)
513129f33fa99 yabasic: 2.90.4 -> 2.90.5 (#361056)
ed3ba5bcadcbc tideways-daemon: 1.9.22 -> 1.9.28
787e9af16340b meli: 0.8.9 -> 0.8.10
038eb3d12b450 tmuxPlugins.session-wizard: 1.3.1 -> 1.4.0
50bc93ce738d1 esphome: fix font component support; 2024.11.2 -> 2024.11.3; platformio: 6.1.15 -> 6.1.16 (#363236)
a37e778bd5466 build(deps): bump korthout/backport-action from 3.0.2 to 3.1.0 (#337448)
5ae7ef9ba8f13 python312Packages.nbdev: 2.3.32 -> 2.3.34
37da6093522bc nixos/k3s: add nftables to Path of k3s service (#360796)
01cda5c4b62d9 ollama: 0.5.0 -> 0.5.1
54edb58943fce python312Packages.django-filer: 3.3.0 -> 3.3.1
f9f59197478b3 homepage-dashboard: 0.9.12 -> 0.9.13 (#363697)
4da7e8106a841 mobilizon: 4.1.0 -> 5.1.0
db86c68dde796 river: 0.3.5 -> 0.3.6 (#363669)
87def1d484d54 inform6: 6.42-r4 -> 6.42-r6 (#361360)
18518e12136ed rsyslog-light: 8.2408.0 -> 8.2412.0 (#361644)
4f93c8ab47587 mmsd-tng: 2.6.1 -> 2.6.2 (#361344)
5a01cfa30e6cd java-service-wrapper: 3.5.59 -> 3.5.60 (#361376)
1ca6aaacc6214 ankama-launcher: 3.12.26 -> 3.12.27
80554728cfbc3 argocd: 2.12.6 -> 2.13.1 (#360628)
bb50811bd3671 gollama: 1.27.19 -> 1.28.0
8b9b72e81521e sendme: 0.18.0 -> 0.19.0 (#360854)
9b3ac1df80c23 dumbpipe: 0.18.0 -> 0.20.0 (#360856)
8153ad4458f0d nixos/librenms: order librenms-setup after network.target
904fabb9ab702 wcslib: 8.3 -> 8.4 (#361224)
cbc56c8d5bccb eid-mw: 5.1.19 -> 5.1.21 (#361266)
c19c1334db8da tqsl: 2.7.3 -> 2.7.5 (#361209)
22f827a64439c gwyddion: 2.66 -> 2.67 (#361274)
ef904439e7675 debianutils: 5.20 -> 5.21 (#361293)
23c1faaff6115 ci/eval: re-implement compare in nix (#362844)
06c1654169416 uwsgi: 2.0.27 -> 2.0.28 (#361268)
563c8a32c08b7 keepalived: 2.3.1 -> 2.3.2 (#361280)
e950436be2c14 hsqldb: 2.7.3 -> 2.7.4 (#361296)
256591515b0b7 kubernetes-polaris: 9.5.0 -> 9.6.0 (#360873)
f8d7c24657788 genymotion: 3.7.1 -> 3.8.0 (#361267)
3979765270db0 istioctl: 1.23.2 -> 1.24.1 (#360566)
0da8ff0a7a8e3 converseen: 0.12.2.3 -> 0.12.2.4 (#360877)
b2a15ae45cf87 badger: 4.4.0 -> 4.5.0
c8208b913b024 avalanchego: 1.12.0-initial-poc.6 -> 1.12.0 (#360525)
87b5e76c193a0 harmonia: 1.0.2 -> 2.0.0 (#362948)
16970f5a0fc5c mark: 11.2.0 -> 11.3.0 (#360764)
07eb7f52144d8 xfsprogs: 6.11.0 -> 6.12.0 (#362380)
b0a3c141bac18 sbt-with-scala-native: 1.10.2 -> 1.10.6 (#360693)
b6bddf1850051 kubebuilder: 4.3.0 -> 4.3.1 (#360848)
c6482b9c66c2c hermitcli: 0.40.0 -> 0.41.0 (#360706)
fc78b5b198f0b harsh: 0.10.4 -> 0.10.6
c19915b3225f8 fn-cli: 0.6.35 -> 0.6.36 (#360859)
40fbebcaeb5be pifpaf: 3.2.1 -> 3.2.3 (#360729)
8acfeeef1911f clipboard-jh: 0.9.1 -> 0.10.0 (#360751)
2551fa34fca10 harmonia: 2.0.0 -> 2.0.1
d0ebdb144b009 coursier: 2.1.14 -> 2.1.19 (#360882)
e635ae627a615 procs: 0.14.7 -> 0.14.8 (#360837)
820a996d6c802 bun: 1.1.34 -> 1.1.38
0914a1050d52a homepage-dashboard: 0.9.12 -> 0.9.13
c016c46cef87e vscode-extensions.visualjj.visualjj: 0.13.1 -> 0.13.3 (#363691)
85c969faad55c protonmail-desktop: 1.5.1 -> 1.6.0 (#363365)
8853307a2f150 commitlint-rs: 0.1.12 -> 0.2.2 (#361660)
acef98a67061d zed-open-capture: init at unstable-2023-24-19, use in rtabmap, add myself as rtabmap maintainer (#362858)
452cd9d4567d7 kine: 0.13.3 -> 0.13.6 (#363319)
db343a60d97e4 nomnatong: 5.12 -> 5.13 (#360664)
3f5a19e2d58f5 vscode-extensions.visualjj.visualjj: 0.13.1 -> 0.13.3
1ac98af94b3df etc-overlay: mount the metadata image read-only (#360756)
43d27c33ec5ae librespot: 0.5.0 -> 0.6.0 (#360296)
b64dec7857109 lunar-client: 3.2.26 -> 3.3.1 (#360481)
aa8c5c74fd526 cargo-binstall: 1.10.13 -> 1.10.16
e4eb3e8115039 zef: 0.22.4 -> 0.22.6 (#360600)
c83877f767a17 joplin-desktop: 3.0.15 -> 3.1.24
7fb4bfcbd4582 svp: fix fhsenv version (#363180)
dbad61f93b5a4 srgn: 0.13.3 -> 0.13.4 (#360560)
9db79a5788187 kernel-hardening-checker: 0.6.6 -> 0.6.10 (#360454)
5014c5dba895c terraform-ls: 0.34.3 -> 0.36.0 (#360530)
25ffef2469b41 vmware-horizon-client: fix fhsenv version (#363164)
9a67590b3c5cb ruplacer: 0.9.0 -> 0.10.0 (#360475)
ada08ab4eca5f ssm-session-manager-plugin: 1.2.677.0 -> 1.2.694.0 (#360259)
e608e50294527 steam-rom-manager: 2.5.22 -> 2.5.29
467da0d6be526 havn: 0.1.16 -> 0.1.17
d003aefa7005b publii: 0.45.2 -> 0.46.2 (#363093)
1331edaea7955 mangojuice: init at 0.7.8 (#354321)
d03fb7215e7f7 python312Packages.oci: 2.135.1 -> 2.139.0
a51505e088a6f handheld-daemon: 3.6.1 -> 3.7.0 (#361364)
3c9a1fe232388 nixos/wakapi: don't merge EnvironmentFile paths (#363205)
ff5ffbd32324e kikoplay: init at 1.0.3 (#354929)
e1edfba5a149d python312Packages.homematicip: 1.1.3 -> 1.1.5 (#362729)
6400e8d74d108 chatzone-desktop: 5.2.1 -> 5.2.3 (#360941)
d936a6e08405f trunk: 0.21.1 -> 0.21.4 (#360470)
80e73f44faf35 uncrustify: 0.80.0 -> 0.80.1
0618ebc8c8bec pinniped: 0.33.0 -> 0.35.0 (#360469)
dce92e62e795a v2raya: add cliPackage option (#334876)
491e332feb1b9 home-assistant: refresh cherry-picks (#363666)
dab4fe53545ba peazip: 10.0.0 -> 10.1.0 (#362704)
178a034ad9a5d ci: Update pinned Nixpkgs (#363585)
1217a5647fdd5 goimports-reviser: 3.7.4 -> 3.8.2
9a141f71051b2 amarok: 3.1.0 -> 3.1.1 (#360464)
e5be2e81df780 powerpipe: 1.0.0 -> 1.0.1
8fccdde2b7000 river: 0.3.5 -> 0.3.6
f6029466451a8 deno: 2.1.2 -> 2.1.3 (#362818)
2b03b37393032 nixos/tests/home-assistant: call with runTest
579ade1ed8370 nixos/tests/home-assistant: fix testing of restart with new dependency
be150023f7c37 nixos/tests/home-assistant: fix reload expectations
ee59cca0f1044 nixos/home-assistant: add reference to signal handling section
28b8aa8c4c986 nixos/home-assistant: support extraArgs
179fd97dae9b5 nixos/home-assistant: update component hardening lists
00b9d1f7546ba nixos/home-assistant: replace global `with lib`
c15ee9113fe31 v2ray: 5.20.0 -> 5.22.0 (#359639)
4d17a765b5ba9 mgba: 0.10.3 -> 0.10.4 (#363159)
d9cff315d1f63 grafana: 11.3.1 -> 11.4.0 (#363193)
d81dea3bbbb96 meshcentral: 1.1.33 -> 1.1.35 (#363225)
5cdeee4b055a6 c-blosc2: 2.15.1 -> 2.15.2 (#359868)
106cf3d281e70 libdict: fix darwin build
a44f4541d023d nym: 2024.12-aero -> 2024.13-magura-patched (#358978)
52dcc88971f74 libdict: 1.0.3 -> 1.0.4
21b973775711b kanidm: permit hydra to build unmaintained 1.3 release
97958e72e8a92 kanidm: add back 1.3 compatibility
75763a2f41b06 nixos/librenms: enableLocalBilling + memory limit for cronjobs (#361153)
c6400fbd21ef7 drm_info: 2.3.0 -> 2.7.0 (#344022)
d75618dc7aaee graalvm-ce: 23.0.0 -> 23.0.1 (#359838)
4b41775396659 upsun: 5.0.22 -> 5.0.23
e504ed26d2491 python312Packages.python-openstackclient: add requests socks support
588b138a93537 cargo-aoc: init at 0.3.8 (#362859)
30931fd4ee739 platformsh: 5.0.22 -> 5.0.23
2b375c0504793 yadm: 3.2.2 -> 3.3.0 (#360982)
af67084ffee9c cynthion: 0.1.7 -> 0.1.8
597095c55119e blasfeo: 0.1.4 -> 0.1.4.1
a5deae39a3656 uxn: 1.0-unstable-2024-10-19 -> 1.0-unstable-2024-11-30 (#362697)
8b047c001484d {gama-tui,gocovsh,golds,pkgsite,tcount}: init (#358316)
5d946517527ac gimpPlugins.{bimp,gap}: fix build (#362644)
de7106e9e59b7 rocksdb: 9.7.3 -> 9.7.4 (#360541)
435ce773a8bcc cilium-cli: 0.6.20 -> 0.6.21 (#363300)
d277b7abe39cd secp256k1: 0.5.1 -> 0.6.0 (#354528)
588558184800e kimai: 2.24.0 -> 2.26.0 (#363640)
33fe023937c12 lib/types: make pattern of strMatching accessible (#350467)
27157b0fad4b2 clightning: 24.08.2 -> 24.11 (#363637)
f41c166f0190a matomo-beta: 5.0.0-rc9 -> 5.2.0-rc1
00553f86fd2ed matomo_5: 5.1.1 -> 5.1.2
0b83ab49d58c8 matomo: format
6b1f76fc14b04 matomo: use finalAttrs for accessing version
0cbe48b03fe41 cargo-about: 0.6.5 -> 0.6.6
e88f8a86d461e shotcut: 24.10.13 -> 24.11.17 (#359989)
860b17cd04925 keka: 1.3.2 -> 1.4.6 (#359964)
f5a5157f1f9a7 Update jdreaver email, remove as prowlarr maintainer (#362954)
fd70a5989a37b doppler: 3.69.2 -> 3.70.0
3fe041e8bfddf lib.types: Add test for merging strMatching
b61c03c641bdb github-runner: fix wrong path in the config file (#363599)
752f274b7d201 pyspread: 2.3 -> 2.3.1 (#362699)
b9b7fddc39671 mopac: 23.0.2 -> 23.0.3 (#363335)
227f91ba10d03 clightning: 24.08.2 -> 24.11
e2b57d2cd7300 kimai: 2.24.0 -> 2.26.0
27b00e4d75b20 wlink: 0.1.0 -> 0.1.1 (#363354)
b70d1d6989137 libretro.stella: 0-unstable-2024-11-17 -> 7.0-unstable-2024-12-09
23d1d5c8be0b1 kryptor: .NET 6 -> 8
bc259d48fa5fc kryptor: refactor
fbe94be2e3e1a picocrypt-cli: 2.09 -> 2.10 (#363348)
631bbf1dea273 ttdl: 4.5.0 -> 4.7.0
2b455a03e1974 libretro.snes9x: 0-unstable-2024-10-28 -> 1.63-unstable-2024-12-08
878ced9a7f253 ltex-ls-plus: init at 18.2.0 (#357814)
2f8de5b0dbc7b github-runner: fix wrong path in the config file
c2a355e310fb4 sopwith: 2.6.0 -> 2.7.0 (#362724)
c152995942ff5 python312Packages.minari: 0.5.1 -> 0.5.2
3737fabfe8c20 libretro.mrboom: 0-unstable-2024-07-01 -> 5.5-unstable-2024-10-21
afba9fc8e177e marcel: 0.30.1 -> 0.30.4
a73246e2eef4c quakespasm: 0.96.0 -> 0.96.3 (#261759)
626206b9db10e box86: 0.3.6 -> 0.3.8 (#363498)
1b7de0a3e7d12 prowlarr: remove jdreaver as maintainer
baefe064a22f0 maintainers: update jdreaver email
f05e64a83f7bb arti: 1.3.0 -> 1.3.1 (#363089)
6b41e525a1ee6 mactracker: init at 7.13
7acb5c5b59fb4 vtfedit: init at 1.3.3 (#258646)
062945b725875 lib.types: chore use consistent payload form (#363565)
e11c52a2321b1 vendir: 0.42.0 -> 0.43.0
1d6a2c28a4986 lib.types: add release notes
231bf6e2d0209 ltex-ls-plus: init at 18.3.0
c7035f64bd57c vimPlugins.nvim-lspconfig: 2024-12-02 -> 2024-12-08 (#363412)
8616590df9b42 python312Packages.xonsh: 0.18.4 -> 0.19.0
0ae50bd8e7673 steampipePackages.steampipe-plugin-aws: 1.3.0 -> 1.4.0
8a44f79f611d0 terraform-providers.ovh: 1.0.0 -> 1.1.0 (#363537)
a11b7373b9d06 terraform-providers.launchdarkly: 2.21.0 -> 2.21.2 (#363540)
2341e4fb60dea vimPlugins.nvim-lspconfig: 2024-12-02 -> 2024-12-08
a5916cbe70d8a terraform-providers.vault: 4.4.0 -> 4.5.0 (#363547)
9431dcc532d83 kryptor: nixfmt
838504b53cbae sof-firmware: 2024.09 -> 2024.09.2 (#363257)
63fad607bab81 home-assistant-custom-components.miele: 2024.8.1 -> 2024.11.1
83bf38e6303e1 python312Packages.homematicip: 1.1.4 -> 1.1.5
bd54c82797a2a python312Packages.homematicip: fix license
a2e94a7006c65 lib.types: attrsWith named placeholder (#344216)
ff8576f191960 dockerTools.pullImage: accept `hash` parameter (#342400)
7f458c52303f9 python312Packages.pymiele: refactor
7a06221563a04 python312Packages.pymiele: 0.1.7 -> 0.2.0
e79a903b7c595 k8sgpt: 0.3.46 -> 0.3.48
d504a1e68085d lib.types.attrsWith: add placeholder parameter
20dc18a4652a8 tippecanoe: 2.70.0 -> 2.72.0 (#363522)
1008102caf6fc super-slicer: fix build with GCC 14 (#362194)
83092be1a2de7 terraform-providers.auth0: 1.7.3 -> 1.8.0 (#363572)
16b57a9ad0e90 stylua: 2.0.1 -> 2.0.2
8da25ff830fad scooter: 0.1.2 -> 0.2.1
5a5236baeab3a cargo-deny: 0.16.2 -> 0.16.3 (#363484)
d979e89d88114 ci: Update pinned Nixpkgs
aa12cad9e92d6 railway: 3.18.0 -> 3.19.1 (#363248)
cace7bca604f7 minigalaxy: 1.3.0 -> 1.3.1
ef913a6f49b4d okteto: 3.1.0 -> 3.2.0
c5cd729138168 llama-cpp: 4154 -> 4293 (#363528)
8128cb79a2425 terraform-providers.mailgun: 0.7.6 -> 0.7.7 (#363490)
8ae4064d708f8 nixos/bookstack: fix unintended escaping of nginx locations
3767e8e9850d8 kubectl-explore: 0.10.0 -> 0.11.0 (#363493)
fb93de56bcaab keymapper: 4.9.0 -> 4.9.1 (#363508)
d262d14bc260e python312Packages.execnb: 0.1.8 -> 0.1.11 (#363510)
1b52efe8c2f1f nix-prefetch-scripts: add bash to inputs
423832f4118b1 smbclient-ng: 2.1.6 -> 2.1.7 (#363447)
67b443d3e078c prometheus-pve-exporter: 3.4.5 -> 3.4.6
1d1499520b70e nixpacks: 1.29.1 -> 1.30.0 (#363454)
b47831eb1ff4b toot: 0.47.0 -> 0.47.1 (#363457)
416d8e80911d9 mystmd: 1.3.17 -> 1.3.18 (#363413)
f5a88025cd6cf kubeshark: 52.3.89 -> 52.3.91 (#363419)
5720f42c329d9 nix-prefetch-docker: provide `hash` in SRI format
d0e6b0e170391 dockerTools.pullImage: accept `hash` parameter
f7cdf7ceafca3 puncia: 0.24 -> 0.25 (#363420)
795d679a3a8fa immich: 1.122.1 -> 1.122.2 (#363421)
5a98c1bbbd220 butane: 0.22.0 -> 0.23.0 (#363427)
2090f8415798e csvlens: 0.10.1 -> 0.11.0 (#363431)
6a4d532bb7f7c rednotebook: 2.35 -> 2.36
2a0938b7f0a1c pocketbase: 0.23.1 -> 0.23.4 (#362555)
afbfb638322b7 jotdown: 0.6.0 -> 0.7.0 (#363433)
fb3130b2efd8f python312Packages.withings-sync: 4.2.6 -> 4.2.7
e81df5bb2d85e terraform-providers.auth0: 1.7.3 -> 1.8.0
4cec7a0136fff python312Packages.pymodbus: 3.7.4 -> 3.8.0
bc27f0fde01ce doomrunner: 1.8.2 -> 1.8.3 (#363206)
f407f6f57ec12 lib.types: chore use consistent payload form
5ed5910063937 mate.atril: 1.28.0 -> 1.28.1 (#363014)
7c55714c64b2f amdgpu_top: 0.9.2 -> 0.10.0
597f6fff71a10 libgedit-gtksourceview: 299.3.0 → 299.4.0
f3a4513ef4457 libgedit-tepl: 6.11.0 → 6.12.0
514ac0ca05697 clickhouse-backup: 2.6.3 -> 2.6.4
bbc9fdd29045a cri-tools: 1.31.1 -> 1.32.0
a4803b6c4426a imgpkg: 0.43.1 -> 0.44.0
323a11c675048 conda: 4.11.0 -> 24.9.2 (#359910)
2add8b96f5803 clash-meta: 1.18.10 -> 1.19.0
e6a34bc793157 nym:	2024.12-aero -> 2024.13-magura-patched
ddbfef49719e0 c3-lsp: 0.3.2 -> 0.3.3
1625f3e2ee2f2 dooit: 3.0.4 -> 3.1.0 (#363526)
00fc1904d4841 tree-sitter-grammars.tree-sitter-twig: init (#355404)
24a21639bb38d snac2: 2.63 -> 2.65 (#363545)
3d4d757e19a53 snpguest: 0.7.1 -> 0.8.0 (#363471)
62a5ae3481fda android-studio: 2024.2.1.9 -> 2024.2.1.12 (#363548)
543f37fb1e2c4 snapmaker-luban: 4.10.2 -> 4.14.0 (#360053)
346cdedbff265 python312Packages.galario: fix build (#363044)
e215eaaf3d026 mmv: 2.8 -> 2.10
fd6bc1b590d6e typos: 1.28.1 -> 1.28.2 (#363521)
056d01b905361 ytdl-sub: 2024.11.6 -> 2024.12.4 (#362832)
d304322e37350 android-studio: 2024.2.1.9 -> 2024.2.1.12
a348bbd7e3830 traefik: 3.1.4 -> 3.2.1 (#360213)
1a9dbc6e2fa9c terraform-providers.vault: 4.4.0 -> 4.5.0
bfa12bdee5b5f snac2: 2.63 -> 2.65
786ff942e699b libvirt: 10.9.0 -> 10.10.0 (#363499)
4131bb43a1bc5 wireshark: fix build on darwin
b780aeae00a73 cve: 1.7.0 -> 1.7.1 (#362932)
b0873cb0e32c1 electron-source.electron_33: 33.0.2 -> 33.3.0
0b9542d99d9cd electron-source.electron_32: 32.2.2 -> 32.2.7
ae8467475dbfd electron-source.electron_31: 31.7.2 -> 31.7.6
90cb09d5f966d electron-chromedriver_33: 33.0.2 -> 33.3.0
2f6cfd79a18dd electron-chromedriver_32: 32.2.2 -> 32.2.7
06a1f5b729e6f electron-chromedriver_31: 31.7.2 -> 31.7.6
8b10e86a67ce3 electron_33-bin: 33.0.2 -> 33.3.0
ae863e8023501 electron_32-bin: 32.2.2 -> 32.2.7
a9f019764914a electron_31-bin: 31.7.2 -> 31.7.6
b13d95d119066 python3Packages.recipe-scrapers: add missing isodate dependency (#363242)
7a6ffaba3eb99 cowsay: 3.8.3 -> 3.8.4
20eda972b6bf3 steampipe: 1.0.0 -> 1.0.1
504c7ce212392 terraform-providers.launchdarkly: 2.21.0 -> 2.21.2
4ba53df99319c chatzone-desktop: 5.2.1 -> 5.2.3
08fc0bd4a59d8 cargo-outdated: 0.15.0 -> 0.16.0 (#363392)
2116a70346b6d obs-studio-plugins.obs-3d-effect: 0.1.1 -> 0.1.2 (#363504)
73c4d98a70da7 openvpn3: 23 -> 24 (#363360)
97c1562b58c2a openjph: 0.17.0 -> 0.18.1 (#362619)
c73e02fc5f465 yq-go: 4.44.5 -> 4.44.6 (#363514)
7961132c80eb7 terraform-providers.ovh: 1.0.0 -> 1.1.0
f9f6201eb5ae3 fluent-bit: 3.1.10 -> 3.2.2 (#363253)
8f8d4054fa353 python312Packages.weblate-language-data: 2024.13 -> 2024.14 (#363269)
3ef3f6f430b1e python312Packages.craft-application: 4.4.0 -> 4.5.0 (#363440)
e2a0786661b73 pulsarctl: 4.0.0.4 -> 4.0.0.8
5c26d67667b7a python3Packages.python-apt: 2.8.0 -> 2.9.2
b356fafe02dd1 nixos/nginx: don't disable IPC (#360008)
fbf117facf0bd hyprlauncher: 0.2.7 -> 0.2.8 (#363444)
a5ca609b8ec5e prometheus-cpp: 1.1.0 -> 1.3.0, reformat, finalAttrs, fix pkgsStatic (#363342)
0ff2ef60bd1f7 files-cli: 2.13.180 -> 2.13.202
66bd38db4d073 llama-cpp: 4154 -> 4293
ff6fe6ec6d021 dooit: 3.0.4 -> 3.1.0
2cf68f2bf3765 handheld-daemon: 3.6.2 -> 3.7.0
cc0941133bb27 tippecanoe: 2.70.0 -> 2.72.0
e876e2ff03ac4 typos: 1.28.1 -> 1.28.2
ead4a829f130a git-workspace: 1.7.0 -> 1.8.0 (#363507)
d0f5305ec155e jbang: 0.120.4 -> 0.121.0
7996ffc5cf0c7 git-workspace: remove passthru.tests.version
79c02078a6950 maa-assistant-arknights: 5.9.0 -> 5.10.2 (#363442)
a3cb20422a21a python312Packages.bidsschematools: 0.11.3.post3 -> 1.0.0 (#363258)
c34c8fee74ef4 python312Packages.pytelegrambotapi: 4.24.0 -> 4.25.0
d1599517ffbea sqlite-vec: 0.1.5 -> 0.1.6
fa704a00bada9 python312Packages.pyomo: 6.8.1 -> 6.8.2
342f4df14e877 python312Packages.pytest-examples: 0.0.14 -> 0.0.15
10461f3b233a8 sftpgo: 2.6.3 -> 2.6.4
98ebb7e0b2b59 janet: 1.36.0 -> 1.37.1
463f9342eb6bc yq-go: 4.44.5 -> 4.44.6
c94ae7a159eb8 handheld-daemon: 3.6.1 -> 3.6.2
de75b9175823e magic-wormhole-rs: various cleanups (#363002)
d163a0ea76f7f cedar: init at 4.2.2 (#360328)
67004e9b81d11 python312Packages.execnb: 0.1.8 -> 0.1.11
617f0f1ff28b1 yazi, yazi-unwrapped: 0.3.3 -> 0.4.0 (#363326)
bd4edc04bb1f1 keymapper: 4.9.0 -> 4.9.1
749ef6034057f git-workspace: 1.7.0 -> 1.8.0
285e50f44fb40 url-parser: 2.0.5 -> 2.1.1 (#363284)
89f193eb344fb nixos-rebuild-ng: improve documentation (#361750)
de30f0aaefd10 cava: 0.10.2 -> 0.10.3
ed65a89903db2 obs-studio-plugins.obs-3d-effect: 0.1.1 -> 0.1.2
af8de4f367afd abctl: 0.22.0 -> 0.23.0
b251e97823809 minio-client: 2024-10-02T08-27-28Z -> 2024-11-17T19-35-25Z
f7865885ff4af python312Packages.py-tes: 0.4.2 -> 1.1.0 (#362853)
45f702a6d3b65 python312Packages.google-cloud-spanner: 3.50.1 -> 3.51.0 (#363343)
0f1016f3428f4 quark-engine: 24.11.1 -> 24.12.1 (#363453)
c011c8e282140 vuls: 0.27.0 -> 0.28.0 (#363280)
0e6fd21adbc27 python312Packages.pymc: 5.18.2 -> 5.19.1 (#363489)
79c949613d29a python312Packages.fastcore: 1.7.23 -> 1.7.25 (#363491)
0c4ab62092686 python312Packages.githubkit: 0.12.0 -> 0.12.1 (#363291)
647dbf324efa5 python312Packages.millheater: 0.12.0 -> 012.2 (#363293)
827f43390e6fd nixos/zapret: remove maintainer (#363494)
a8c5dc11d9823 box86: 0.3.6 -> 0.3.8
889fb165d6f4e libvirt: 10.9.0 -> 10.10.0
c734fb7fd5eea minify: 2.21.1 -> 2.21.2
9451bb51c25b6 nixos/zapret: remove maintainer
45364c3d8a6d2 ngtcp2-gnutls: 1.8.0 -> 1.9.1 (#355866)
16d0a9cbd1e67 kubectl-explore: 0.10.0 -> 0.11.0
943626e75a75b terraform-providers.mailgun: 0.7.6 -> 0.7.7
c72d33fea7289 python312Packages.fastcore: 1.7.23 -> 1.7.25
353b6a7e7dd04 xemu: 0.7.133 -> 0.7.134
5e3363a8652d9 tana: 1.0.17 -> 1.0.18
2e98ec0e0eb30 nixos/networking-interfaces-scripted: use read -r
f388bc8e8794c go-blueprint: 0.8.2 -> 0.10.1 (#363158)
2b73f72f4a895 python312Packages.pymc: 5.18.2 -> 5.19.1
e745dac703387 ktor-cli: 0.3.0 -> 0.3.1
b644a1b90a386 cargo-deny: 0.16.2 -> 0.16.3
977c9efc5128f uiua-unstable: init at 0.14.0-dev.6 (#362951)
2aa1c476a808f gnome-extensions-cli: 0.10.3 -> 0.10.4
51ef6cbc6ab82 genemichaels: 0.1.21 -> 0.5.7
753dacd783990 snpguest: 0.7.1 -> 0.8.0
e4c9d406a042b doc/languages-frameworks/python: Reword section to make commit rules a bit clearer (#339643)
759f603acdc26 rustic: 0.9.4 -> 0.9.5 (#362575)
13659a54fcdcf nixos/qgroundcontrol: fix qgroundcontrol module (#336183)
6d127499d0093 grip-grab: init at 0.3.0 (#346658)
414c290f3b825 nixos/galene: add turnAddress option and fix httpAddress (#353421)
6137b22220246 nixos/qemu-vm: minor readability improvements (#339681)
dbd30ceb34246 _010editor: init at 15.0.1 (#331313)
88492ebb5eb35 python312Packages.cashews: 7.3.1 -> 7.4.0
7602b65a1b2ac tela-circle-icon-theme: 2024-04-19 -> 2024-11-15
9e866bbdbf438 terraform-providers.linode: 2.29.1 -> 2.31.1
9e32ef890f476 terraform-providers.bitwarden: 0.12.0 -> 0.12.1
fdc1fed984d50 terraform-providers.newrelic: 3.52.1 -> 3.53.0
c05f640eac9d0 terraform-providers.temporalcloud: 0.0.14 -> 0.0.15
ab45bc5c01732 toot: 0.47.0 -> 0.47.1
73b7d880f14c8 prometheus-cpp: 1.1.0 -> 1.3.0
4e3ef907e4636 nixpacks: 1.29.1 -> 1.30.0
0f9c9444be62f quark-engine: 24.11.1 -> 24.12.1
8b96d79a35210 storj-uplink: 1.116.5 -> 1.118.8 (#363298)
125617542b23e smbclient-ng: 2.1.6 -> 2.1.7
81a0c13d148df ngtcp2: 1.8.1 -> 1.9.1
2ee01474dac2a ngtcp2-gnutls: 1.8.0 -> 1.9.1
1f40ab520224d dart.fvp: use FindMDK.cmake (#362163)
1387bde191a65 plex: fix fhsenv version (#363160)
6a44de21f2660 unityhub: fix fhsenv version (#363161)
4e20984e9f1d8 electron-fiddle: fix fhsenv version (#363165)
f826db6cd1d65 expressvpn: fix fhsenv version (#363167)
501f919f42cd3 kingstvis: fix fhsenv version (#363169)
a411d3c264cf2 typora: fix fhsenv version (#363170)
e18074974126c left4gore-bin: fix fhsenv version (#363171)
fb70f75220722 nixos/filesystems: assert when `label` and `device` are set simultaneously (#362481)
4c5af09bfd20b dart.xdg_directories: init (#363174)
ec45e9439b707 qownnotes: 24.11.2 -> 24.12.1
a3b773a440f6e hyprlauncher: 0.2.7 -> 0.2.8
b04d6346f9131 eccodes: 2.36.0 -> 2.39.0 (#349680)
cf2ec54707d3a buf: 1.47.0 -> 1.47.2
6bdff18e166e6 python312Packages.albumentations: 1.4.20 -> 1.4.22
1577d591765f7 treewide: add aleksana to maintainer of various gtk packages (#363198)
b79eed116ebec cargonode: init at 0.1.2 (#361643)
94191f40ce165 python312Packages.albucore: 0.0.19 -> 0.0.21
d993c6113ded8 python312Packages.simsimd: init at 6.2.1
43c5569fb2863 dotnetCorePackages.patchNupkgs: fix patchelf usage (#361450)
4e97bcd8d3128 maa-assistant-arknights: 5.9.0 -> 5.10.2
db46aae5a194e python312Packages.craft-application: 4.4.0 -> 4.5.0
0c59a020c7a35 ocamlPackages.earlybird: 1.3.2 -> 1.3.3 (#362955)
18208c490751c marwaita: 22.2 -> 23 (#363049)
3d6f2a38fd6b9 ticker: 4.7.0 -> 4.7.1 (#363341)
0ef44a488f3d9 oversteer: 0.8.1 -> 0.8.3 (#362937)
239a55c50ac48 wasmer: 5.0.2 -> 5.0.3 (#362987)
d66bcbe6b37a7 ppsspp: 1.18 -> 1.18.1 (#363133)
363c25038f6ad docify: 1.0.0 -> 1.1.0 (#363067)
d92224a31826a home-assistant-custom-components.xiaomi_gateway3: 4.0.6 -> 4.0.7 (#362791)
996876ae82a9c audiobookshelf: 2.17.4 -> 2.17.5
8da14e862a252 vips: 8.15.5 -> 8.16.0 (#362444)
987c7c1efcbd7 python312Packages.stripe: 11.2.0 -> 11.3.0 (#363305)
54c5bca8e63c6 python312Packages.gftools: 0.9.74 -> 0.9.76 (#363364)
4c1f7d2d96146 libvmi: 0.14.0-unstable-2024-09-18 -> 0.14.0-unstable-2024-11-06
f3f887a69a988 kubectl-node-shell: 1.10.2 -> 1.11.0 (#363402)
cbdff0d7a815f home-assistant-custom-lovelace-modules.mushroom: 4.2.0 -> 4.2.1 (#363414)
1942705da8f4e python312Packages.rich-click: 1.8.4 -> 1.8.5 (#363418)
061cb7ad5d1cf wit-bindgen: 0.34.0 -> 0.36.0 (#363308)
7cedac469e616 jotdown: 0.6.0 -> 0.7.0
53bd25e9e250a kanboard: init at 1.2.42 (#357229)
1dae76d033d09 nixos/redmine: Change type of services.redmine.stateDir to `path`
a4762bf346e67 csvlens: 0.10.1 -> 0.11.0
a1cccc5e39dc5 nsd: 4.10.1 -> 4.10.2
a963fa59d0264 butane: 0.22.0 -> 0.23.0
c2a7c0ae1060e istatmenus: init at 7.02.10 (#358251)
ac0efff3ffa65 carapace: 1.0.7 -> 1.1.0
68a4ce374c19f aerospace: 0.15.2-Beta -> 0.16.2-Beta (#360172)
59d6168e194dd anki: 24.06.3 -> 24.11 (#361951)
621e924eb3d95 puncia: 0.24 -> 0.25
bdeec57ec9b28 kubeshark: 52.3.89 -> 52.3.91
19c2f6aaaa05c stochas: 1.3.12 -> 1.3.13 (#362837)
02eacd08188c2 objfw: 1.2.1 -> 1.2.2 (#362999)
ee1578a67a2b6 anydesk: 6.3.3 -> 6.4.0 (#363015)
459c979a16b3e oterm: 0.6.1 -> 0.6.9 (#363016)
bf1799238e711 jellyfin-ffmpeg: 7.0.2-5 -> 7.0.2-7 (#360761)
e87d084a557fd spotify-player: 0.20.1 -> 0.20.3 (#362864)
a7e75bbc8dac3 slack: 4.41.97 -> 4.41.98 (#362745)
9aadd04e27f7a python312Packages.rich-click: 1.8.4 -> 1.8.5
8dc553b708022 immich: 1.122.1 -> 1.122.2
d78473f98f8ed teams-for-linux: 1.11.2 -> 1.12.3 (#363028)
a3709ab6feba4 poetry: 1.8.4 -> 1.8.5 (#362620)
3e973ae2ebc7b python312Packages.safety: 3.2.9 -> 3.2.11
9b5895bdc95ed python312Packages.safety-schemas: 0.0.5 -> 0.0.10
cd5f63c597b65 python312Packages.dparse: 0.6.3 -> 0.6.4
7abc8ebc78974 rust-analyzer-unwrapped: 2024-11-11 -> 2024-12-02
6c3cb218ab707 home-assistant-custom-lovelace-modules.mushroom: 4.2.0 -> 4.2.1
b4fe70ac92bbc mystmd: 1.3.17 -> 1.3.18
b6dbf6deed81e nixos/filesystems: assert that the device and label options are consistent
5d83d5b20b978 calls: 46.3 -> 47.0
a181967099dfb nodePackages.create-react-native-app: drop (#363374)
f304ede4f4dc1 terraform-providers.google-beta: 6.9.0 -> 6.12.0
ae2356ff4553f terraform-providers.signalfx: 9.1.6 -> 9.5.0
0019995430d20 terraform-providers.datadog: 3.46.0 -> 3.49.0
3231455e5383f terraform-providers.opentelekomcloud: 1.36.23 -> 1.36.26
91cdcf7e36091 wasm-tools: 1.221.0 -> 1.221.2
0f4b646923ad8 terraform-providers.migadu: 2024.10.10 -> 2024.11.28
bcd5b037fd518 zf: 0.9.2 -> 0.10.2
700d34f0038d2 terraform-providers.huaweicloud: 1.69.1 -> 1.71.0
960dd2e2979ab zf: Format with nixfmt
8e10d955b875f terraform-providers.sentry: 0.14.0 -> 0.14.1
a45fb10b4384c terraform-providers.artifactory: 12.3.1 -> 12.5.1
28b89ed40af43 terraform-providers.grafana: 3.10.0 -> 3.14.1
6e2beb51f708d terraform-providers.aiven: 4.28.0 -> 4.30.0
99e0e2a925a11 mitmproxy: 11.0.1 -> 11.0.2 (#362931)
25fe86dff71eb nodePackages.expo-cli: drop (#361284)
92d15e18a5737 criu: 3.19 -> 4.0 (#348314)
a589eaf97e3c7 simulide: correct version definition (#362667)
afc324d90d98c opentofu: fix passhthru test
22a2f067415f1 synchrony: init at 2.4.5 (#352833)
9b5953d3ab4b5 fastly: 10.17.0 -> 10.17.1
efdaa6b75cf48 python312Packages.huggingface-hub: 0.26.3 -> 0.26.5 (#362595)
2f10891b9b147 python312Packages.pyiceberg: init at 0.8.1 (#362591)
f5e46f66856e1 kubectl-node-shell: 1.10.2 -> 1.11.0
70c6e3245b529 fabric-ai: 1.4.99 -> 1.4.119
2a15b6b7a1f71 yamlscript: 0.1.83 -> 0.1.86
51efc5d161941 mpris-timer: 1.1.1 -> 1.5 (#363042)
78cfe2d72362f cargo-outdated: 0.15.0 -> 0.16.0
18252dd3e121e ocamlPackages.srt: 0.3.0 -> 0.3.1 (#352262)
a6c79004e02d6 avalanchego: 1.12.0-initial-poc.6 -> 1.12.0
31b70b95dd6de spring-boot-cli: 3.3.4 -> 3.4.0 (#360293)
db8159c1d6674 rmapi: 0.0.27.1 -> 0.0.28 (#360214)
68e0b955377e9 vector: 0.42.0 → 0.43.0 (#363330)
bd34fda3e4cfb python312Packages.accelerate: 1.1.0 -> 1.2.0 (#362616)
bebdc90a976f9 z-lua: 1.8.19 -> 1.8.20 (#360245)
31fe12124c173 rabbitmq-c: 0.14.0 -> 0.15.0 (#357641)
fe16f46dbfc9d kuma: 2.8.3 -> 2.9.1 (#359165)
eb61f8aff5464 ocamlPackages.containers: 3.14 -> 3.15 (#356382)
4c97bc4a76607 versatiles: 0.13.0 -> 0.14.5 (#363023)
5e0585161b8cf writeShellApplication: fix shellcheck availability check (#362868)
5d23bf256c023 panicparse: 2.3.1 -> 2.4.0 (#360051)
75e745bc6020b azpainter: 3.0.9a -> 3.0.10 (#360256)
75d31ebf553c7 automatic-timezoned: 2.0.38 -> 2.0.40
01461c8918acd flclash: 0.8.69 -> 0.8.70
109f05c89daec rdkafka: 2.6.0 -> 2.6.1 (#360134)
81ce2e980effe ibus-engines.typing-booster-unwrapped: 2.25.17 -> 2.26.11 (#359240)
a7ff9f0dd1245 mysql_jdbc: 9.0.0 -> 9.1.0 (#359753)
0fbc786cf3b1a tartube-yt-dlp: 2.5.040 -> 2.5.059 (#359511)
775b0348679d9 stm32cubemx: 6.12.1 -> 6.13.0
8ab176b3f9546 mob: 5.3.1 -> 5.3.3 (#360105)
cd6abe59e0834 mmseqs2: 15-6f452 -> 16-747c6 (#362040)
80f9a6b175505 home-assistant-custom-lovelace-modules.universal-remote-card: 4.2.0 -> 4.2.1 (#363351)
b928ad0093c9b nixos-rebuild-ng: only show the error message if the user forget to use --ask-sudo-password flag
69d9c3529d13a nixos-rebuild-ng: fix repl command
f6a5be36f3b04 dart.fvp: use FindMDK.cmake
0afd5fbf4018d mdk-sdk: 0.30.0 -> 0.30.1
a9e9c06463815 papermc: 1.21.1-119 -> 1.21.3-53 (#358578)
f968abfcfa185 mdk-sdk: format
8d3c9632ea356 lilypond-unstable: 2.25.20 -> 2.25.21 (#358402)
5c14a84b23d3c nvme-cli: 2.10.2 -> 2.11 (#363036)
62ccf2557301a libnvme: 1.11 -> 1.11.1 (#363045)
e857cfa8a1941 nixos/seafile: fix systemd option capitalization for RandomizedDelaySec (#363324)
338de35f6357e woof-doom: 15.0.0 -> 15.0.1, add nix-update-script (#362407)
34efbc5743977 python312Packages.scalene: 1.5.47 -> 1.5.49 (#362531)
6d8f27f3bb439 python312Packages.gftools: 0.9.74 -> 0.9.76
280703fb6fac6 cloudflare-dynamic-dns: 4.3.9 -> 4.3.11
3a9f2af3509b7 python312Packages.rapidocr-onnxruntime: 1.3.24 -> 1.4.1 (#362580)
b8783fbefa4ce databricks-cli: 0.234.0 -> 0.236.0
c45b460d606f8 openvpn3: 23 -> 24
339a3006ecd6b gdbuspp: 2 -> 3
61dfad04c4822 maintainers: add second key to progrm_jarvis
e998856e5908d codeql: 2.19.3 -> 2.19.4
ace01cb5e78d4 python312Packages.pynecil: 1.0.1 -> 2.0.2 (#361553)
7f4e91025b8a6 postfix: 3.9.0 -> 3.9.1 (#361965)
41ccfd7dbbe75 sirikali: 1.6.0 -> 1.7.2 (#363320)
0cd431e6e04d1 netbird-ui: 0.33.0 -> 0.34.1
39128a6e9ef5e openscad-unstable: 2024-11-18 -> 2024-12-06 (#362750)
2cab71191a150 wlink: 0.1.0 -> 0.1.1
68309feeb72b0 picocrypt-cli: 2.09 -> 2.10
dd51f52372a20 traefik-certs-dumper: 2.8.3 -> 2.9.3 (#363277)
8b4f7534abfb3 python312Packages.google-cloud-spanner: 3.50.1 -> 3.51.0
febb399d545e7 ticker: 4.7.0 -> 4.7.1
3dd3225b53d9f prometheus-cpp: use finalAttrs pattern
36e312cb5fdeb prometheus-cpp: reformat
0e61feebaaf55 mopac: 23.0.2 -> 23.0.3
f150343e710da vector: 0.42.0 → 0.43.0
73b9f2d20bea9 scx.full: 1.0.6 -> 1.0.7; nixos/scx: add new schedulers (#363306)
a431fc0eeaf68 gyroflow: 1.5.4-2024-09-05 -> 1.6.0 (#362262)
bbc7df36746ed dart-sass: 1.80.5 -> 1.82.0 (#362962)
cdc0fa7a9eb77 sirikali: 1.6.0 -> 1.7.2
ac5e3695e4d05 kine: 0.13.3 -> 0.13.6
e5bddbcbb5db2 nixos/lib/make-squashfs: set root mode to 0755 (#363247)
aadc58324eac0 node-gyp: 10.2.0 -> 10.3.1 (#361544)
d274b40960aa9 cockpit: 328 -> 329.1 (#360017)
b4aacf5ab5ad3 nixos/scx: add new schedulers
962bd73da6e8c lite-xl: 2.1.5 -> 2.1.6 (#360046)
19e986a191694 ghidra-extensions.findcrypt: 3.0.2 -> 3.0.3
eed56f3092055 vgm2x: 0-unstable-2024-06-18 -> 0-unstable-2024-11-17 (#360009)
1a1cb8b7268f5 xpipe: 13.2 -> 13.4.3
b693631e7a895 cargo-bolero: 0.11.2 -> 0.12.0 (#359954)
e4df86a26b70b sqldef: 0.17.23 -> 0.17.24 (#359922)
df399abc316a3 scx.full: 1.0.6 -> 1.0.7
563c21191ff06 wit-bindgen: 0.34.0 -> 0.36.0
b1d2b1d82b7b0 kafkactl: 5.3.0 -> 5.4.0 (#359872)
add9b9454827d legends-of-equestria: init at 2024.05.01
3d07314b448c7 cocogitto: 6.1.0 -> 6.2.0 (#359854)
16f826c776f2c mariadb-connector-java: 3.4.1 -> 3.5.1 (#359679)
1ecc2ecf8d400 seaweedfs: 3.79 -> 3.80 (#363154)
233ca281cdd57 reveal-md: 6.1.3 -> 6.1.4 (#359613)
467a923e35f0a xray: 24.9.30 -> 24.11.21 (#359578)
368b27b002908 python312Packages.stripe: 11.2.0 -> 11.3.0
e4627c2140e8b cilium-cli: 0.16.20 -> 0.16.21
f00eb1996fc2b cilium-cli: reformat with nixfmt
0a5d125b5e75f cilium-cli: 0.16.19 -> 0.16.20 (#359569)
b7b3589f0700f kops_1_30: 1.30.1 -> 1.30.2 (#359489)
62e7006a1f24f git-pw: 2.6.0 -> 2.7.0 (#359560)
68620d5ee6b1a p2pool: 4.1.1 -> 4.2 (#357487)
f1e8f3c850f1c sickgear: 3.32.10 -> 3.32.11 (#359527)
924b5f4a7cd4c brainflow: 5.14.0 -> 5.15.0 (#362921)
9280573ae8524 dracula-theme: 4.0.0-unstable-2024-10-03 -> 4.0.0-unstable-2024-11-26 (#359429)
c94f4c1fbb81f funzzy: 1.2.0 -> 1.5.0 (#359398)
e3e16dae5f9c8 storj-uplink: 1.116.5 -> 1.118.8
85b68634c6064 pachyderm: 2.11.4 -> 2.11.5 (#359276)
3902bf91af5a7 quarto: 1.6.33 -> 1.6.37 (#359188)
8dc3db8d5e968 twilio-cli: 5.22.3 -> 5.22.6 (#359381)
a8537d11984b3 nixos/wakapi: don't merge EnvironmentFile paths
397d5fb54a054 rqlite: 8.31.2 -> 8.34.1 (#358217)
1b11e94b9b1b0 terraform-plugin-docs: 0.19.4 -> 0.20.1 (#362736)
906be16c3c6ad python3Packages.zenoh: init at 1.0.3
a66e967913cfb ocamlPackages.asai: 0.3.0 -> 0.3.1 (#357868)
91448da034ab8 kubernetes-helmPlugins.helm-unittest: 0.5.2 -> 0.6.3 (#357517)
03173ec0e9d82 fioctl: 0.42 -> 0.43 (#357568)
26602151b1671 python312Packages.millheater: 0.12.0 -> 012.2
91fb266745575 gitlab: 17.5.2 -> 17.6.1 (#359329)
eaa3254a36850 python312Packages.awkward: 2.7.1 -> 2.7.2 (#363221)
0cd2216f1c339 crowdsec: 1.6.3 -> 1.6.4 (#357584)
95f685b969b8c attic-client: 0-unstable-2024-10-06 -> 0-unstable-2024-11-10 (#356653)
5bc0c47d23ca4 python312Packages.githubkit: 0.12.0 -> 0.12.1
62faa98e61f2f python312Packages.coincurve: fix build
2b32ebcaf001e secp256k1: 0.5.1 -> 0.6.0
cf1435f066396 raspberrypi-eeprom: 2024.11.08-2712 -> 2024.11.12-2712 (#363272)
90194e892ae77 url-parser: 2.0.5 -> 2.1.1
732d21150dfa9 qdrant-web-ui: 0.1.31 -> 0.1.33 (#359219)
38216d3d30e15 weaviate: 1.26.6 -> 1.27.5 (#359217)
564f029dc459a linuxPackages.nct6687d: 0-unstable-2024-09-02 -> 0-unstable-2024-11-05 (#361739)
7e938775be586 libdjinterop: 0.20.2 -> 0.22.1 (#362866)
39b8048b95a2f snappymail: 2.38.1 -> 2.38.2 (#359233)
6d9c3a8ec8b6e pioasm: 2.0.0 -> 2.1.0 (#359026)
c9530e33adcd6 zimfw: 1.15.0 -> 1.16.0 (#359204)
a0714ece49708 ocamlPackages.gsl: 1.25.0 -> 1.25.1 (#359017)
366b59a9e2b39 jackett: 0.22.893 -> 0.22.998 (#358802)
9a8ed4dfb1e16 vuls: 0.27.0 -> 0.28.0
708ebaf7d99d4 vscode-js-debug: 1.94.0 -> 1.95.3 (#358961)
01a9722d61616 fend: 1.5.3 -> 1.5.5 (#358850)
0da0c88fca7da python312Packages.simple-dftd3: 1.2.0 -> 1.2.1 (#362943)
9cbb457919b18 python312Packages.llm: 0.19 -> 0.19.1 (#362942)
5ffd748d8121e seafile-client: 9.0.9 -> 9.0.11 (#362941)
aaf899a85b093 cargo-tally: 1.0.50 -> 1.0.56 (#362935)
5a57e8e68fc32 terraform-providers.infoblox: 2.7.0 -> 2.8.0 (#362953)
565d54368839c python312Packages.numpyro: 0.15.3 -> 0.16.1 (#362982)
86fb96252b398 typstyle: 0.12.8 -> 0.12.9 (#363267)
1544a19df5d06 stevenblack-blocklist: 3.14.127 -> 3.14.139 (#362983)
9d7cad76e9366 traefik-certs-dumper: 2.8.3 -> 2.9.3
b08e39d5f882c cyberpunk-neon: 0-unstable-2024-09-15 -> 0-unstable-2024-11-07 (#362993)
8b395e9e12367 erlang-language-platform: 2024-07-16 -> 2024-11-07 (#354182)
f7ead4ae963a6 cubiomes-viewer: 4.1.0 -> 4.1.2 (#358918)
1806dfdbfefd3 hackgen-font: 2.9.0 -> 2.9.1 (#362998)
283fc96aa588e sesh: 2.5.0 -> 2.6.0 (#358791)
01c1603369be3 gat: 0.19.1 -> 0.19.2 (#363007)
1148f702b4b6a hackgen-nf-font: 2.9.0 -> 2.9.1 (#363009)
ff011d9ea35dd micronaut: 4.6.3 -> 4.7.1 (#358696)
7b35bf0dcb205 heroku: 9.3.0 -> 9.5.0 (#358626)
616ecb305e2ff graalvmCEPackages.graalpy: 24.0.1 -> 24.1.1 (#358439)
b9104d21b9dc5 graalvmCEPackages.truffleruby: 24.0.1 -> 24.1.1 (#358440)
28cc998859fe1 acme-sh: 3.0.9 -> 3.1.0 (#358510)
899200c312e77 sketchybar-app-font: 2.0.27 -> 2.0.28 (#363010)
9a2798a35bbaa obs-studio-plugins.obs-teleport: 0.7.2 -> 0.7.3 (#363012)
6a024a96c56a1 git-cliff: 2.6.1 -> 2.7.0 (#357695)
6f0aa869f9a1f graalvmCEPackages.graalnodejs: 24.0.1 -> 24.1.1 (#358434)
1d1db5501b7ed superhtml: 0.5.1 -> 0.5.3 (#363020)
49fd2da72db40 raspberrypi-eeprom: 2024.11.08-2712 -> 2024.11.12-2712
38352113e3968 git-credential-oauth: 0.13.3 -> 0.13.4 (#363024)
232c4fac6bd84 ols: 0-unstable-2024-10-27 -> 0-unstable-2024-11-30 (#363029)
691a088779144 hydrus: 595 -> 598 (#356543)
b72ca1a2d981e ghciwatch: 1.0.1 -> 1.0.2 (#363046)
555342a84c9a5 initool: 0.18.0 -> 1.0.0 (#356986)
cacb9adf342eb virtio-win: 0.1.262-2 -> 0.1.266-1 (#363053)
6951ad985b0d6 linux_xanmod_latest: 6.11.10 -> 6.11.11 (#362536)
71177e2d9efb5 typstyle: 0.12.8 -> 0.12.9
87fa3cb07f6d6 i3-rounded: unstable-2021-10-03 -> 4.21.1 (#356706)
6e698297de774 kubeone: 1.8.3 -> 1.9.0 (#358152)
2e816793bf437 apacheHttpdPackages.mod_wsgi3: 5.0.1 -> 5.0.2 (#363055)
c8221cb2c7b16 python312Packages.multiscale-spatial-image: 2.0.1 -> 2.0.2
25bcf6d2122d8 google-java-format: 1.24.0 -> 1.25.0 (#358090)
70e5d6e5fbe8a python312Packages.weblate-language-data: 2024.13 -> 2024.14
ac26bcf0ac45d vue-language-server: 2.1.6 -> 2.1.10 (#357954)
e4e4131cf6117 astc-encoder: 5.0.0 -> 5.1.0 (#363057)
bb719c9c70d38 azure-storage-azcopy: 10.27.0 -> 10.27.1 (#363059)
822b8de281465 python312Packages.yappi: 1.6.4 -> 1.6.10 (#363060)
b95c7d3cfbbb8 bazelisk: 1.22.1 -> 1.24.1 (#363070)
fcc17ab52fb2d airshipper: 0.14.0 -> 0.15.0 (#356847)
d437245ed2173 pscale: 0.213.0 -> 0.216.0 (#363072)
350693fb78258 csvtk: 0.31.0 -> 0.32.0 (#363073)
41d75bb8ad8ad rush-parallel: 0.5.7 -> 0.6.0 (#363088)
fbdd3db7f7d63 gql: 0.29.1 -> 0.32.0 (#363096)
e59bb6d887185 tabby: 0.19.0 -> 0.20.0 (#356719)
f465baa98a66d python312Packages.aiovlc: 0.6.3 -> 0.6.5 (#363243)
fc7408b078723 ejson: 1.5.2 -> 1.5.3 (#363240)
1f6d475e8915e dnsproxy: 0.73.2 -> 0.73.4 (#363233)
6876876a8bf35 python312Packages.django-pgactivity: 1.5.0 -> 1.7.0 (#363227)
3ff3948043d23 python312Packages.django-pglock: 1.6.0 -> 1.7.0 (#363226)
cb530357bc778 Merge GNOME updates 2024-12-07 (#362830)
73285e54fc5a3 gtree: 1.10.12 -> 1.10.13 (#363224)
407cce1988339 python312Packages.scikit-rf: 1.4.1 -> 1.5.0 (#363223)
e1383b9e2d991 swayimg: 3.5 -> 3.6 (#363155)
6894773263bab libphidget22: 1.20.20240909 -> 1.21.20241122 (#362437)
2a4b345062547 leetgo: 1.4.10 -> 1.4.11 (#363220)
f599bf659e5ff cargo-leptos: 0.2.21 -> 0.2.22 (#363219)
85bbbd49f2cdb gh-poi: 0.11.0 -> 0.12.0 (#363192)
aa258618afa69 python312Packages.cmsdials: 1.4.0 -> 1.5.0 (#363197)
606c3f81debb2 linuxPackages.shufflecake: 0.4.4 -> 0.5.1 (#343906)
d6e4987465116 python312Packages.qbittorrent-api: 2024.10.68 -> 2024.11.70
1db42df03d1d9 rustdesk-server: 1.1.11-1 -> 1.1.12 (#345257)
fd4fb3ea6e524 python312Packages.django-silk: 5.3.0 -> 5.3.1 (#363199)
bb5b58da73b67 gnmic: 0.39.0 -> 0.39.1 (#363200)
463f36906ed2a sslh: 2.1.2 -> 2.1.3 (#363202)
9fa93980e8a95 cargonode: refactor
4e3b003c26c42 sarasa-gothic: 1.0.24 -> 1.0.25 (#363004)
dc46520f19239 sof-firmware: 2024.09 -> 2024.09.2
7ece479f390f9 nixos/k3s: add extraKubeProxyConfig option to add nftables to k3s's path
ca3e22c152be8 mystmd: 1.3.8 -> 1.3.17 (#344840)
9d75005cbc735 fluent-bit: 3.1.10 -> 3.2.2
4283353e502d4 python312Packages.aws-lambda-builders: 1.51.0 -> 1.53.0 (#363207)
32c087e7007f5 nagiosPlugins.check_esxi_hardware: 20221230 -> 20241129 (#363214)
25888d5201bbd libphidget22extra: 1.20.20240909 -> 1.21.20241122
73c66179fcafb python312Packages.pycep-parser: 0.4.2 -> 0.5.1 (#363166)
1d36526990000 sozu: 1.0.4 -> 1.0.6 (#338113)
98928a7dbebef libphidget22: 1.20.20240909 -> 1.21.20241122
2a7340e5a5123 wambo: 0.3.1 -> 0.4.0 (#363173)
2610eaea7602c python312Packages.mlxtend: 0.23.2 -> 0.23.3 (#363186)
01f0a7a17ae70 virter: 0.28.0 -> 0.28.1 (#363187)
93e5eaa91dfa2 mdbook-katex: 0.9.1 -> 0.9.2 (#363190)
b58a64c648446 marwaita-red: 22.2 -> 23
51f8b10077977 gobgpd: 3.30.0 -> 3.32.0
c8672fdc9207f python312Packages.bimmer-connected: 0.16.4 -> 0.17.2 (#363138)
44500244ab26a gobgp: 3.30.0 -> 3.32.0
11e28293f83b5 slumber: 2.2.0 -> 2.3.0 (#363145)
da18b9bc79a0c nixos/lib/make-squashfs: set root mode to 0755
a6e299ffc3ce8 fermyon-spin: 2.5.1 -> 3.0.0 (#321380)
191156e148a59 signal-cli: 0.13.9 -> 0.13.10 (#363146)
58872406ef45b semantic-release: 24.1.2 -> 24.2.0 (#363150)
3569e62b7d1b1 roxctl: 4.5.4 -> 4.6.0 (#363151)
84b4196a3109a flycast : 2.3.2 -> 2.4 (#363153)
44a8a98877ea7 rutorrent: 4.2.10 -> 5.1.1 (#339286)
029261a6088a3 promptfoo: 0.57.1 -> 0.79.0 (#336299)
4c1b600bc3531 railway: 3.18.0 -> 3.19.1
63169766000e5 arkade: 0.11.29 -> 0.11.31 (#363107)
d30e9cf3be1cc proto: 0.42.0 -> 0.43.1 (#363108)
b88b1e1f85937 aiken: 1.1.5 -> 1.1.7 (#363111)
3c388cd53cf72 python3Packages.recipe-scrapers: add missing isodate dependency
a178f43f027df tf-summarize: 0.3.11 -> 0.3.14 (#363112)
909365d2203fe makima: 0.9.4 -> 0.9.5 (#363116)
11de6df9ecd54 ctlptl: 0.8.35 -> 0.8.36 (#363118)
2f12b90e517c0 hyprland-workspaces: 2.0.3 -> 2.0.4 (#363119)
08fdedb4ae636 python312Packages.aiohomeconnect: 0.6.3 -> 0.6.4 (#363122)
fe499b85a05f8 platformio: 6.1.15 -> 6.1.16
95f671e120c98 faudio: 24.11 -> 24.12 (#363123)
b08332680422f telepresence2: 2.20.2 -> 2.20.3 (#363125)
aceaf618b5122 esphome: 2024.11.2 -> 2024.11.3
3cceacf98e57a parallel-disk-usage: 0.10.0 -> 0.11.0 (#363117)
86d2c28dce86c julia-bin: autoPatchelf manually to avoid mangling cache (#362412)
a9df0430f6824 marwaita-yellow: 20.3.1 -> 23
79f0b0ea1dc27 fcitx5-mcbopomofo: 2.8 -> 2.8.1 (#362786)
48bbe09b337d1 f2: 2.0.1 -> 2.0.3 (#363115)
b7589ab8b9984 Merge remote-tracking branch 'upstream/master' into add-cargonode-0.1.2
f1aabc677e526 python312Packages.aiovlc: 0.6.3 -> 0.6.5
f4bd97b8face6 firefox_decrypt: 1.1.0 -> 1.1.1 (#303403)
1fb74f82fbcd4 kotlin-native: 1.9.23 -> 1.9.24
6db7d02ec9dad esphome: fix font component support
6ecd54854294f ejson: 1.5.2 -> 1.5.3
b76c1b95695fb hyperrogue: 13.0r -> 13.0v (#328328)
da038375f54ef fermyon-spin: 2.5.1 -> 3.0.0
60ce27bdbdacc ocamlPackages.happy-eyeballs: 1.1.0 -> 1.2.2 (#291072)
011e45dfea194 dnsproxy: 0.73.2 -> 0.73.4
d6a5445e6d15e nextcloud30Packages: update
cce2e76d65fc4 nextcloud29Packages: update
56ee225e9f602 nextcloud28Packages: update
41dbe7bc6f482 nextcloud29: 29.0.9 -> 29.0.10
9eb9123185b8d todesk: fix fhsenv version (#363177)
cddf4e4164ad8 python312Packages.django-pgactivity: 1.5.0 -> 1.7.0
fe5dd00baede3 python312Packages.django-pglock: 1.6.0 -> 1.7.0
a68fdbb81277f nixos/bazecor: init (#359143)
df084a4d3cdc7 gtree: 1.10.12 -> 1.10.13
303b423a72164 python312Packages.openai: 1.54.5 -> 1.56.1 (#359638)
5c0ec0e184b9e leetgo: 1.4.10 -> 1.4.11
b7eae8cb6ad3d gitlab: 17.5.2 -> 17.6.1
fe6d0eafb7916 python312Packages.scikit-rf: 1.4.1 -> 1.5.0
a4c052b235aeb python312Packages.awkward: 2.7.1 -> 2.7.2
64f5dc11a50db python312Packages.awkward-cpp: 42 -> 43
54c9a211dcfd0 cargo-leptos: 0.2.21 -> 0.2.22
afb08a9a49090 colima: 0.7.6 -> 0.8.0 (#362988)
e273c861fdf7c pg_top: 4.1.0 -> 4.1.1 (#362306)
96fb4aa761032 qtractor: 1.3.0 -> 1.4.0 (#362322)
b96c1acf29bfd lug-helper: 3.0.1 -> 3.5 (#362507)
0738fa469189b jbrowse: 2.16.0 -> 2.17.0 (#362906)
ee0e06ba220ee seq66: 0.99.15 -> 0.99.16 (#362885)
2c012c271b15f p3x-onenote: 2024.10.110 -> 2024.10.117 (#362741)
a4dd29c8e1947 collector: 0-unstable-2024-08-02 -> 0-unstable-2024-11-11 (#362618)
489684bd572cd lug-helper: 3.0.1 -> 3.5
7ac201834e08d qtractor: 1.3.0 -> 1.4.0
51cba623611da pg_top: 4.1.0 -> 4.1.1
cb8881f5bab90 nagiosPlugins.check_esxi_hardware: 20221230 -> 20241129
261ac4c6d94e1 api-linter: 1.67.4 -> 1.67.6 (#360858)
9a93846333827 ocamlPackages.mdx: 2.4.1 → 2.5.0
92010bb67200d vkd3d: 1.13 -> 1.14 (#362025)
c26d7acf6eeba ord: 0.21.2 -> 0.21.3 (#363132)
b070d5b9cd1d5 yoshimi: 2.3.3.1 -> 2.3.3.2 (#361984)
79ba1ef1e0bdd opensoundmeter: 1.3 -> 1.4 (#361712)
ea816de2d7595 tutanota-desktop: 250.241025.0 -> 253.241126.2 (#360330)
70832518c5000 alfaview: 9.17.0 -> 9.18.1 (#360355)
dbe8b6806b431 ballerina: 2201.10.1 -> 2201.10.3 (#360417)
a179bb0b45638 obs-studio-plugins.obs-source-record: 0.3.5 -> 0.4.1 (#360557)
234ee36b74343 whatsapp-for-linux: 1.6.5 -> 1.7.0 (#360595)
c70679219d22b dxx-rebirth: 0.60.0-beta2-unstable-2024-08-11 -> 0.60.0-beta2-unstable-2024-11-16 (#360650)
bc3b847e734dc python312Packages.aws-lambda-builders: 1.51.0 -> 1.53.0
411d22c977b97 pineapple-pictures: 0.8.2.1 -> 0.9.0 (#363204)
3b285176fc3c6 camunda-modeler: 5.28.0 -> 5.30.0 (#360772)
f5bf523e2a275 kube-router: 2.2.2 -> 2.3.0 (#360836)
1cf823acaa50a roxterm: 3.14.3 -> 3.15.3 (#360327)
657012932d5fc victoriametrics: 1.105.0 -> 1.107.0 (#362767)
442924a1436dc cozy-drive: 3.40.0 -> 3.41.0 (#360322)
1aa60be35b53e wl-mirror: 0.16.5 -> 0.17.0 (#360295)
55c0d422316cf asahi-nvram: 0.2.1 -> 0.2.3 (#359852)
99a52b38e25f1 asahi-bless: 0.3.0 -> 0.4.1 (#359847)
8b157cbc69338 questdb: 8.1.2 -> 8.2.0 (#359242)
4bb333c19a0ba bngblaster: 0.9.8 -> 0.9.12 (#359230)
878229d903792 flannel: 0.25.7 -> 0.26.1 (#358613)
a44b29add1911 doomrunner: 1.8.2 -> 1.8.3
ae14ba9ecdacf radicle-node: 1.0.0 → 1.1.0 (#363185)
530f5127e8672 ansel: 0-unstable-2024-09-29 -> 0-unstable-2024-10-28 (#358584)
d84326b291e40 yubikey-touch-detector: 1.11.0 -> 1.12.0 (#358056)
c862264431b1d hubstaff: 1.6.26-95441346 -> 1.6.28-fafb0aba (#357712)
0c53b7c1c8c3f termius: 9.7.2 -> 9.8.5 (#357445)
9b0b118d9b7a9 pineapple-pictures: 0.8.2.1 -> 0.9.0
ec2cdef13b2e5 yourkit-java: 2024.9-b158 -> 2024.9-b159 (#356657)
140aaee1dee6d nixos/paperless: add 'database.createLocally' (#359563)
1682e84eed1b0 sslh: 2.1.2 -> 2.1.3
1c6cf5010081a mongodb-compass: 1.44.4 -> 1.45.0 (#351657)
c8b654f516bae olvid: 1.6.2 -> 2.2.0 (#348283)
c140dc89ded71 treewide: add aleksana to maintainer of various gtk packages
d86b822e23739 jibri: 8.0-169-g1258814 -> 8.0-173-g77dc5a9 (#345570)
69dc2f2fd39d2 jicofo: 1.0-1090 -> 1.0-1104 (#345380)
d2dc9dea8ac16 jitsi-meet-prosody: 1.0.8091 -> 1.0.8242 (#345073)
7340c820a60c3 jitsi-videobridge: 2.3-160-g97a1f15b -> 2.3-174-gd011ddf7 (#344945)
ad84974d6c960 gnmic: 0.39.0 -> 0.39.1
d1e3a9df37b45 python312Packages.django-silk: 5.3.0 -> 5.3.1
fe0ed7965d3fe python312Packages.cmsdials: 1.4.0 -> 1.5.0
d1b64813f69f7 mapnik: 4.0.3 -> 4.0.4 (#362984)
e1569905327a8 railway-wallet: 5.17.10 -> 5.19.4 (#338729)
7efb3e4fb266a qjackctl: 0.9.13 -> 0.9.91 (#307704)
d013bf0d553b9 nixos/services.evcc: remove `with lib;`
9709ae3d48abf nixos/services.ebusd: remove `with lib;`
3344c302e25f7 nixos/services.usbrelayd: remove `with lib;`
a5b237c027e1f nixos/services.trezord: remove `with lib;`
21a586465750e nixos/hardware.sane.dsseries: remove `with lib;`
bbea258a9dc6c nixos/hardware.sane.brscan5: remove `with lib;`
5cbb902a798d8 nixos/hardware.sane.brscan4: remove `with lib;`
e7095ad753dd5 nixos/services.actkbd: remove `with lib;`
ae5e538219c31 nixos/services.mchprs: remove `with lib;`
e8df83b3d2f00 nixos/services.gemstash: remove `with lib;`
2a63acaac6b4f nixos/services.bloop: remove `with lib;`
19fb7137b0657 nixos/services.zeitgeist: remove `with lib;`
e323870fc81d7 nixos/services.malcontent: remove `with lib;`
e693f4b95392c nixos/services.geoclue2: remove `with lib;`
eeda33831185a nixos/services.espanso: remove `with lib;`
793ecf787783f nixos/services.deepin.dde-daemon: remove `with lib;`
db321b974ab79 nixos/services.redis: remove `with lib;`
36828aceef0de nixos/services.mongodb: remove `with lib;`
035c17d4080bc nixos/services.monetdb: remove `with lib;`
261e4890fbfeb nixos/services.memcached: remove `with lib;`
3aa36dd181490 nixos/services.cockroachdb: remove `with lib;`
fa6f1e3ce5d48 nixos/services.clickhouse: remove `with lib;`
f6ebc4cfe0d57 nixos/services.aerospike: remove `with lib;`
67553951b1be6 nixos/services.gocd-agent: remove `with lib;`
d575253885cd4 nixos/services.github-runners: remove `with lib;`
5ee4c4b0a127c nixos/services.buildbot-worker: remove `with lib;`
c41bc079d16bb nixos/services.kubernetes.scheduler: remove `with lib;`
ac653187c5745 nixos/services.kubernetes: remove `with lib;`
697d1c36603c8 nixos/services.kubernetes.controllerManager: remove `with lib;`
e75e6693b7904 nixos/services.kubernetes.apiserver: remove `with lib;`
42a84adc1c43f nixos/services.kubernetes.addonManager: remove `with lib;`
c1109e87b0539 nixos/services.hadoop.yarn: remove `with lib;`
e7e4c15a192a0 nixos/services.hadoop.hdfs: remove `with lib;`
decec5eaa373b nixos/services.hadoop.hbase*: remove `with lib;`
e5c3196d1724e nixos/services.hadoop: remove `with lib;`
ddcd8d565e60a nixos/services.corosync: remove `with lib;`
5c7e172a284b5 nixos/security.sudo: remove `with lib;`
430f4e9c5e566 nixos/security.pam: remove `with lib;`
97b9c7bfcc221 nixos/security.lockKernelModules: remove `with lib;`
264f1b4941e47 nixos/security.googleOsLogin: remove `with lib;`
89f9d95e025e0 nixos/security.duosec: remove `with lib;`
6f58cc224f096 nixos/security.doas: remove `with lib;`
011b094cddf33 nixos/security.chromiumSuidSandbox: remove `with lib;`
8d0fd73946268 nixos/security.pki: remove `with lib;`
770156285cda2 rocmPackages_5.rocm-docs-core: 0.26.0 -> 1.8.2 (#298142)
706ff352b00a9 gh-poi: 0.11.0 -> 0.12.0
27d764403273a pilipalax: remove useless xdg-user-dirs
97fcdafc591e5 oneanime: remove useless xdg-user-dirs
82108e2d6be88 mangayomi: remove useless xdg-user-dirs
a239f788801f5 kazumi: remove useless xdg-user-dirs
7789a66309fce finamp: remove useless xdg-user-dirs
4b01903967ca7 ente-auth: remove useless xdg-user-dirs
de816bea61ebf dart.xdg_directories: init
0bc7caf6fffca obs-studio: fix lossless audio support (#360925)
ab487bb1eacb9 mdbook-katex: 0.9.1 -> 0.9.2
d188530a6c546 hugo: 0.139.0 -> 0.139.3 (#363101)
e33b3d67d1fb3 radicle-node: 1.0.0 → 1.1.0
c4706e1ff0afd virter: 0.28.0 -> 0.28.1
81d5388171ea8 python312Packages.mlxtend: 0.23.2 -> 0.23.3
0eb81e0c50085 vulkan-cts: 1.3.9.0 -> 1.3.10.0 (#359554)
4bbb73beb26f5 reuse: 4.0.3 -> 5.0.2 (#357590)
a9c76a6bade55 cirrus-cli: 0.132.0 -> 0.133.0 (#360155)
656cc69dffe3f python312Packages.psd-tools: 1.10.2 -> 1.10.4 (#362890)
aa8e955336f29 bleep 0.0.9 -> 0.0.11 (#360379)
65224e200ef52 temporal-cli: inherit version of tctl-next (#361683)
47e07506851db gnomeExtensions: update collision renames
965d4fdc0ac2a gnomeExtensions: auto-update
8292dad528503 gnomeExtensions: fault tolerance for update-extensions.py
74f7df7e20fd1 hyprls: 0.2.0 -> 0.3.0 (#362735)
1a8b548c04a08 kazumi: 1.4.4 -> 1.4.5 (#362657)
2c70707f94529 bolt-launcher: init at 0.9.0 (#338470)
ed8ad8bb9829d flclash: 0.8.68 -> 0.8.69 (#362624)
390dc92d8a810 python312Packages.parselmouth: fix build (#363069)
33acffb9dac44 typora: fix fhsenv version
43909072f7adc svp: fix fhsenv version
ccca426d07817 runescape: fix fhsenv version
4d25e6ad76e47 todesk: fix fhsenv version
e6eb5fff7256f libsidplayfp: 2.11.0 -> 2.12.0 (#362232)
6c1f84ae5c49b lisp-modules: detect circular dependencies during quicklisp import (#362645)
a1e40d4f4f5c2 sidplayfp: 2.11.0 -> 2.12.0 (#362235)
4df4b61819cc5 kazumi: 1.4.4 -> 1.4.5
a241ed9843047 vmware-workstation: fix fhsenv version
93dc9803a1ee4 wipeout-rewrite: 0-unstable-2024-07-07 -> 0-unstable-2024-11-09 (#362241)
82633832b8eb3 left4gore-bin: fix fhsenv version
87848285c93c9 python312Packages.pybids: 0.17.2 -> 0.18.1 (#359712)
6a61cccddb66f kingstvis: fix fhsenv version
ee2960706cf5d expressvpn: fix fhsenv version
19f30400517ad wambo: 0.3.1 -> 0.4.0
45bb6b2dfe05d electron-fiddle: fix fhsenv version
71fa8183786ff vmware-horizon-client: fix fhsenv version
7a7cab08b67cb immich: 1.121.0 -> 1.122.1 (#362233)
bff23669cfa3e unityhub: fix fhsenv version
5f1feb132a080 plex: fix fhsenv version
f89e66967c8a6 python312Packages.pycep-parser: 0.4.2 -> 0.5.1
8e2e89ad7cc76 scip-go: 0.1.21 -> 0.1.22 (#362903)
ba4ec0bbf9da5 python312Packages.meilisearch: 0.32.0 -> 0.33.0 (#362852)
506b5c43f9a93 crowdin-cli: 4.3.0 -> 4.4.1 (#362877)
5b36997b92769 python3Packages.pym3u8downloader: init at 0.1.5 (#335463)
c365d339d1eb7 go-blueprint: 0.8.2 -> 0.10.1
5af4c8640f8b2 committed: 1.0.20 -> 1.1.2 (#362914)
8da333068dcc4 flycast : 2.3.2 -> 2.4
db419b1c25f2b swayimg: add myself as maintainers
9338ba39f1d7d swayimg: 3.5 -> 3.6
ed665876c3892 seaweedfs: 3.79 -> 3.80
18843afdea793 flclash: 0.8.68 -> 0.8.69
32b7ca4138b58 roxctl: 4.5.4 -> 4.6.0
b7a11231ac2d2 gnome-decoder : 0.4.1 -> 0.6.1 (#362978)
c266e9e04611c semantic-release: 24.1.2 -> 24.2.0
98b5591e5c824 nixos/rygel: add package option (#355987)
74529de26dacc vscode-extensions.mongodb.mongodb-vscode: 1.9.3 -> 1.10.0 (#363142)
2ff3a17ec4f34 libmediainfo: 24.06 -> 24.11 (#361289)
61351fb050a68 signal-cli: 0.13.9 -> 0.13.10
c8a4f2060efb1 slumber: 2.2.0 -> 2.3.0
82c1a1523912a vscode-extensions.mongodb.mongodb-vscode: 1.9.3 -> 1.10.0
286d8119b6c76 vcpkg: 2024.10.21 -> 2024.11.16
9f4ab93a012e8 mediainfo: 24.06 -> 24.11.1 (#361290)
11a529d9aad67 python312Packages.bimmer-connected: 0.16.4 -> 0.17.2
92a5e138d745b python312Packages.nicegui-highcharts: init at 2.0.2
d948915b09802 dprint: enable doCheck with some skips (#362498)
80391c8b50de8 mighty-mike: init at 3.0.2-unstable (#355139)
54121ecb519e9 gotify-server: 2.5.0 -> 2.6.1 (#363013)
5ff3922534575 nhost-cli: 1.27.1 -> 1.28.1 (#362856)
4d8e8de0d9d66 nixos/mailman: increase uwsgi buffer size
a7123e1267fa5 ppsspp: 1.18 -> 1.18.1
0ffaf9bfca260 bolt-launcher: init at 0.9.0
2c327da4c5b61 mympd: 18.1.2 -> 18.2.2 (#363104)
9a6c27c1a5ea8 python312Packages.nicegui: init at 2.5.0
2a70dcd811391 boxbuddy: 2.3.1 -> 2.5.0 (#363109)
32a7ea3b6b614 ord: 0.21.2 -> 0.21.3
944f47455eefe lib: add defaultTo (#357681)
f94b4bd94574e ci/eval: re-implement compare in nix
603da64471028 python312Packages.pyecharts: init at 2.0.6
ded2850bd2366 python312Packages.pytest-selenium: init at 4.1.0
ad5d635772d0e quarkus: 3.15.1 -> 3.17.3 (#363026)
b9d5919d30fcf check-sieve: init at 0.10 (#361940)
4eca16533945e wormhole-william: install shell completions (#362652)
ca0cd01cc057f tpnote: 1.24.9 -> 1.24.10 (#362971)
89d36600c9f1f python312Packages.llama-cloud: 0.1.4 -> 0.1.6 (#361696)
71fa10deb378f godspeed: unstable-2021-08-27 -> 1.0 (#362810)
0600211f4f028 python312Packages.roadrecon: 1.5.0 -> 1.6.0 (#361705)
14201a8ad0772 yara-x: 0.11.0 -> 0.11.1 (#362596)
a4b3fb4fd7919 trufflehog: 3.84.2 -> 3.85.0 (#362770)
d70223fcef21c conkeyscan: 1.0.0 -> 1.1.0 (#362696)
56b9ef4fa33b7 keepwn: 0.4 -> 0.5 (#362819)
62d5034ad7eb2 telepresence2: 2.20.2 -> 2.20.3
cf43ba25299f5  openrisk: add versionCheckHook  (#362883)
25efd50039256 python312Packages.twentemilieu: 2.1.0 -> 2.2.0 (#362872)
5c4e385210f33 python312Packages.llama-parse: 0.5.14 -> 0.5.17 (#362854)
f357bce739ef3  chaos: refactor (#362731)
c262074a24042 dnsvalidator: init at 0.1-unstable-2023-01-17 (#362574)
269ed3f2cdedb python312Packages.aiohomeconnect: 0.6.3 -> 0.6.4
145339b54775a cri-o-unwrapped: 1.31.2 -> 1.31.3
f4f6def783e4e faudio: 24.11 -> 24.12
e252f12311b42 chiaki-ng: 1.9.1 -> 1.9.2
318f890660556 hyprland-workspaces: 2.0.3 -> 2.0.4
e3f1c50b6b8a2 ctlptl: 0.8.35 -> 0.8.36
3d58debbb5386 wivrn: 0.19 -> 0.22 (#350069)
8fc4745769608 parallel-disk-usage: 0.10.0 -> 0.11.0
0903f996b4d34 makima: 0.9.4 -> 0.9.5
a540ecdf739bd f2: 2.0.1 -> 2.0.3
7a46b732f2c71 tf-summarize: 0.3.11 -> 0.3.14
f30226d8f09bc klog-rs: 0.2.0 -> 0.3.1 (#363019)
f3a6591a24afa aiken: 1.1.5 -> 1.1.7
d12a87265db42 boxbuddy: 2.3.1 -> 2.5.0
abe4322e7654a proto: 0.42.0 -> 0.43.1
f2b92a84549de arkade: 0.11.29 -> 0.11.31
2b0c08d74fa51 mympd: 18.1.2 -> 18.2.2
868be2c9df2ff foomatic-db: update & fix version numbers (#362443)
95d9957040d4f haguichi: 1.5.0 -> 1.5.1 (#362227)
c5b28243506f8 polarity: add nix-update updatescript (#358928)
b83589b0ac647 surrealist: 2.1.6 -> 3.0.8 (#358925)
6a7d80b43fda1 hugo: 0.139.0 -> 0.139.3
8673ed8875e9b alda: 2.2.3 -> 2.3.1 (#359568)
638b2341d1847 mihomo-party: 1.4.5 -> 1.5.12 (#359912)
47bd11bf0dcdc openems: allow building on aarch64-linux (#359424)
4ae6f5fed4960 chezmoi: 2.53.1 -> 2.55.0
01ec2f1721bcf gql: 0.29.1 -> 0.32.0
4be4f7424cb53 linuxPackages.ena: add updateScript, bump version (#360326)
e96a7541814d6 sblast: init at 0.7.0 (#343460)
c80c4a61cc971 open5gs: init at 2.7.2 (#361459)
e03894b00fec8 diesel-cli: 2.2.5 -> 2.2.6 (#361659)
e94fd5d94afb8 passepartui: 0.1.4 -> 0.1.5 (#361668)
00ea4470dbc18 dnf5: 5.2.7.0 -> 5.2.8.1 (#361691)
6e6af1710bcdd harbor-cli: 0.0.1 -> 0.0.2 (#361699)
a65078f73bca6 trafficserver: 9.2.5 -> 9.2.6 (#355733)
e6a2cfb5dbb6e milkytracker: 1.04.00 -> 1.05.01 (#362208)
52e1a27ece7e9 xmrig-mo: 6.22.1-mo1 -> 6.22.2-mo1 (#362411)
a362eb0e58bea arti: 1.3.0 -> 1.3.1
46ed5ba159c9d python312Packages.minio: 7.2.10 -> 7.2.12 (#362485)
295c497ec112e rush-parallel: 0.5.7 -> 0.6.0
ff988427b8535 scarab: 2.5.0.0 -> 2.6.0.0 (#362727)
e5b8a221df06b deepin.deepin-movie-reborn: mark as broken (#362739)
7575daf174cd8 errands: 46.2.6 -> 46.2.7 (#362747)
88a31066d71a9 csvtk: 0.31.0 -> 0.32.0
d5a4c5f65fb79 pscale: 0.213.0 -> 0.216.0
92f9a97372c3a bazelisk: 1.22.1 -> 1.24.1
5c1b62b3d9346 python312Packages.parselmouth: fix build
87860d17da952 python312Packages.pysvn: 1.9.22 -> 1.9.23
afe27494fa857 nixos/wireguard-networkd: init (#259092)
e07423c1c28c2 cargo-aoc: init at 0.3.8
b44f376683e99 python312Packages.nimfa: fix build
1600f8c4647b3 python312Packages.flake8-bugbear: 24.8.19 -> 24.10.31
5c08bcc4ee65e python312Packages.yappi: 1.6.4 -> 1.6.10
97748fc9a517a gama-tui: init at 1.1.4
86490eb4d6ec9 azure-storage-azcopy: 10.27.0 -> 10.27.1
caa61788635af gocovsh: init at 0.6.1
daec649173fa3 golds: init at 0.7.1
e6c0c3a76ef04 astc-encoder: 5.0.0 -> 5.1.0
d88cb592e976c wchisp: use versionCheckHook (#361079)
c584da6436437 Apparmor: Adopt package, nixos module and nixos tests (#359817)
d7e6c27fe11b6 aws-shell: init at 0.2.2 (#355193)
ea9a3af06bd3c apache-answer: init at 1.4.1 (#358897)
5e371003aff43 iproute2mac: rename from darwin.iproute2mac (#363034)
16444b18b921c apacheHttpdPackages.mod_wsgi3: 5.0.1 -> 5.0.2
15205754f34c3 bazecor: 1.5.4 -> 1.6.1 (#362590)
b6dc13b50755a python3Packages.eth-utils: 4.0.0 -> 5.1.0 (#360668)
2c3d765f97a67 geos: remove 3.11 version, not needed any more (#360240)
d87d5c25cd512 brave: 1.73.91 -> 1.73.97
e01c7ba4d73dd virtio-win: 0.1.262-2 -> 0.1.266-1
88ed58906d136 emiluaPlugins.this-thread: 1.0.0 -> 1.0.1
69934911abbfc wlink: use versionCheckHook (#361080)
e90ab5481b82e typora: fix (#362036)
45ccd347abd01 mangayomi: 0.3.75 -> 0.3.8 (#362490)
ddff96bb1b933 code-cursor: 0.43.0 -> 0.43.6 (#362556)
a7f278d01e472 marwaita: 22.2 -> 23
7618f25e267bf firebase-tools: 13.20.2 -> 13.28.0 (#362690)
c55fc278c6c8b gruvbox-material-gtk-theme: init at 0-unstable-2024-08-09 (#362216)
0456552523649 python312Packagesgalario: fix build
f36fd911cc2d5 ghciwatch: 1.0.1 -> 1.0.2
b08017e88db2d python312Packages.azure-mgmt-servicebus: remove unused dependency (#362153)
9c55cd88e3c5b python312Packages.azure-mgmt-hdinsight: remove unused dependency (#362154)
8e6d6fdcb8b28 mpris-timer: restrict platforms to linux
71fb526a35c2a mpris-timer: install binary under correct name
51fe9136d9d08 iproute2mac: rename from darwin.iproute2mac
7946d711304e8 galario: nixfmt
c904e815edf02 nvme-cli: 2.10.2 -> 2.11
6a05139118d67 libnvme: 1.11 -> 1.11.1
d3097b77bf353 ldapnomnom: 1.4.1 -> 1.5.1
9bec61285e3cc mpris-timer: 1.1.1 -> 1.5
dbdc1cee5bbd4 mpris-timer: add updateScript
fd9961b8a4906 reposilitePlugins: init at 3.5.19 (#355505)
fd8fa3fef63bf ols: 0-unstable-2024-10-27 -> 0-unstable-2024-11-30
af4fad1f21ee3 nixos-rebuild-ng: remove --raw from nix-instantiate
ca928339400df teams-for-linux: 1.11.2 -> 1.12.3
8b8864c4198bd quarkus: 3.15.1 -> 3.17.3
a8ceba61ca196 git-credential-oauth: 0.13.3 -> 0.13.4
3dff76a8eed23 bazel-gazelle: 0.39.1 -> 0.40.0 (#362719)
195bd3b83e389 versatiles: 0.13.0 -> 0.14.5
7c80d8a1c2ae0 libgedit-gfls: 0.2.0 -> 0.2.1 (#362996)
c9d7655d47198 superhtml: 0.5.1 -> 0.5.3
0938529cc9271 klog-rs: 0.2.0 -> 0.3.1
7ade458577f0d turnon: init at 1.6.1 (#350284)
0cefc4f47185b oterm: 0.6.1 -> 0.6.9
cb4bdffed6f96 anydesk: 6.3.3 -> 6.4.0
1ceb2dbda1a5b mate.atril: 1.28.0 -> 1.28.1
9d312eed679ad vokoscreen-ng: 4.2.0 -> 4.3.0 (#360742)
58787b620d47c gotify-server: 2.5.0 -> 2.6.1
ff40568ea586a sops: 3.9.1 -> 3.9.2 (#361229)
71b8746b194fa obs-studio-plugins.obs-teleport: 0.7.2 -> 0.7.3
f311fbff25b48 google-cloud-sql-proxy: 2.14.0 -> 2.14.1 (#362924)
49452c1060a06 sketchybar-app-font: 2.0.27 -> 2.0.28
970a263fabcd3 netdata: 1.47.4 -> 1.47.5
11e73d1552d21 hackgen-nf-font: 2.9.0 -> 2.9.1
ce40e4fd47660 gat: 0.19.1 -> 0.19.2
dcea948b11792 anki: skip flaky test
b7390e3686c47 nixos/wireguard-networkd: add release notes entry
a5de36518f153 nixos/wireguard-networkd: init
ecfc044246d7c sarasa-gothic: 1.0.24 -> 1.0.25
2606a241d499d opnborg: 0.1.24 -> 0.1.44 (#362448)
ae031f193eaa0 magic-wormhole-rs: migrate to pkgs/by-name
cbea40be36eb6 magic-wormhole-rs: reformat with nixfmt-rfc-style
bab9b4a93cac6 nixos/cinnamon: Add x-cinnamon-mimeapps.list (#362432)
980e2470baea1 magic-wormhole-rs: enable tests
5d3fb630fb588 magic-wormhole-rs: skip libxcb dependency on Darwin
0faaecba01fdc magic-wormhole-rs: migrate to new apple-sdk pattern
27a08fa0fc873 objfw: 1.2.1 -> 1.2.2
c329f0625c80a dprint: enable doCheck with some skips
bf56fff2609f5 dprint: add kachick as maintainer
7c74092202739 hackgen-font: 2.9.0 -> 2.9.1
45f439bd7ef48 pkcs11-provider: nixfmt
d48876c9b8f67 pkcs11-provider: 0.5 -> 0.6
e7cb26c6e0abd bird: 2.15.1 -> 2.16
ba0f0606c7f5c libgedit-gfls: 0.2.0 -> 0.2.1
ffd10023d76f0 audiobookshelf: 2.17.2 -> 2.17.4 (#361422)
4d4cf60c9f5ae mutter: 47.1 → 47.3
2ba447b765b43 loupe: 47.1 → 47.2
45961f32d77f0 localsearch: 3.8.0 → 3.8.1
342485223dbab gtranslator: 47.0 → 47.1
aee56a2a55102 gnome-user-docs: 47.0 → 47.2
d211ba708b1a6 gnome-user-share: 47.0 → 47.2
343e3df19515b gnome-shell-extensions: 47.1 → 47.2
c2b9cd8edd26f gnome-shell: 47.1 → 47.2
e4e7c17dd8b1d gnome-settings-daemon: 47.1 → 47.2
e574b22c4f43f gnome-remote-desktop: 47.1 → 47.2
c913dfac7adaa gnome-music: 47.0 → 47.1
54d2aad3477c9 gnome-online-accounts: 3.52.1 → 3.52.2
82ad008e922ba gnome-initial-setup: 47.1 → 47.2
c7905a1531809 gnome-control-center: 47.1.1 → 47.2
cb76615528383 cyberpunk-neon: 0-unstable-2024-09-15 -> 0-unstable-2024-11-07
8037b7f2179f4 ankama-launcher: 3.12.24 -> 3.12.26 (#362515)
d5209a89817ca python312Packages.yalexs-ble: 2.5.1 -> 2.5.2 (#362873)
a7f6479cdc606 colima: 0.7.6 -> 0.8.0
f2fc260124258 gnome2.libgnomecanvas: Fix eval with allowed aliases
a6d98860c49de python312Packages.numpyro: 0.15.3 -> 0.16.1
4bf1b4b347ef3 stevenblack-blocklist: 3.14.127 -> 3.14.139
8405459b312bf mapnik: 4.0.3 -> 4.0.4
7e945690180c4 gnome-decoder : 0.4.1 -> 0.6.1
064ee2cb49669 libsoup_2_4: Rename from libsoup
9f377dfe6999e haskellPackages.cabal2nix-unstable: 2024-10-17 -> 2024-12-04
dab3496fa266e gnome2: Remove rest of the aliases
c430f93990443 nghttp2: Use libsoup_3 in passthru.tests
6d753d5c11f92 overlayed: Use libsoup 3.0
a5c8eba19573b spacedrive: Use libsoup 3.0
fd26de120c5dd snx-rs: Use libsoup 3.0
78b998647fbfc wealthfolio: Use libsoup 3.0
0d60f6f66cafa quodlibet: Remove webkitgtk dependency
583501865ae8f quodlibet: Auto-inject libsoup_3 dependency
4fbf61a2b62a5 gancio: add generic updateScript and update to 1.21.0 (#360430)
38d3c1a8c629f tpnote: 1.24.9 -> 1.24.10
1460b3e9052d5 prisma,prisma-engines: 5.22.0 -> 6.0.1 (#359944)
386044c2082ec broot: modernize (#362840)
1e2c885bb936b lurk: add aarch64-linux support (#362757)
a40c58dea8a10 ginkgo: 2.21.0 -> 2.22.0
bd50ced026838 gitsign: 0.10.2 -> 0.11.0 (#362589)
d6a0683ccb51e ungoogled-chromium: 131.0.6778.85-1 -> 131.0.6778.108-1 (#362831)
c13b9231a2283 umr: 1.0.8 -> 1.0.10 (#362535)
b0d48f0a52b50 novelwriter: 2.5.2 -> 2.5.3 (#362576)
60319a2712c06 lla: 0.2.9 -> 0.2.10 (#362577)
9d4887eea159c tomboy-ng: 0.40 -> 0.41 (#362578)
10ec359f00bff crates-tui: 0.1.20 -> 0.1.22 (#362581)
7c9fb83bf5653 vimPlugins.aw-watcher-vim: init at 2023-10-09 (#321472)
d4ac57d31c02e maintainers: add pyrotelekinetic (#362952)
3c1facf9a7a38 uiua-unstable: init at 0.14.0-dev.6
bd6a3a2a4588d ocamlPackages.earlybird: 1.3.2 -> 1.3.3
a00e463c988fc dotnetCorePackages.patchNupkgs: fix patchelf usage
89673d26f0be5 buildFHSEnvBubblewrap: set meta.mainProgram (#358550)
0cdb43baad175 maintainers: add pyrotelekinetic
a474a07ba95cb terraform-providers.infoblox: 2.7.0 -> 2.8.0
1c306ed6f5bc5 geos: remove 3.11 version
1204cff50ba85 dart-sass: 1.80.5 -> 1.82.0
8c3258c180319 uiua: remove legacy darwin deps
3da9d80a6b764 harmonia: 1.0.2 -> 2.0.0
a2e0940d0f0ed aerospace: 0.15.2-Beta -> 0.16.2-Beta
bc4d5823e485c pwsafe: 1.18.0 -> 1.20.0 (#284061)
190bb2e225edf python312Packages.simple-dftd3: 1.2.0 -> 1.2.1
dc698d39e6041 python312Packages.llm: 0.19 -> 0.19.1
305c1bac2ce00 ecc: 1.0.12 -> 1.0.27 (#274222)
45f6b0d80d7e8 seafile-client: 9.0.9 -> 9.0.11
c93b335217221 cni-plugin-flannel: 1.2.0 -> 1.5.1-flannel3 (#283074)
095bd27125a29 eddy: 1.2.1 -> 3.6 (#282232)
86c2777828df3 cargo-tally: 1.0.50 -> 1.0.56
1e56a3b5efd3c remotebox: 2.7 -> 3.4 (#283153)
45523aadbdad4 moonraker: 0.8.0-unstable-2023-12-27 -> 0.9.3-unstable-2024-11-17 (#359404)
83e3724538d1d writeShellApplication: fix shellcheck availability check
c9fecf240b2b3 cve: 1.7.0 -> 1.7.1
3a1877ce56cf6 maintainers: add axka
bfe7ed8ff4b28 traefik: 3.1.4 -> 3.2.1
b3281241647d6 pulsarctl: 2.11.1.3 -> 4.0.0.4 (#242222)
188ac2bf8ac8d mitmproxy: 11.0.1 -> 11.0.2
15f46df973a1f python312Packages.accelerate: 1.1.0 -> 1.2.0
b1dd465e81397 zenoh: initial add 1.0.3 (#361087)
f9bf2712731fa google-cloud-sql-proxy: 2.14.0 -> 2.14.1
def6d0caf379f sblast: init at 0.7.0
0bb88166c2f6c brainflow: 5.14.0 -> 5.15.0
df05b65b13fe8 tealdeer: move to pkgs/by-name (#362874)
f8dd57be66445 gh-copilot: 1.0.1 -> 1.0.5 (#362565)
a435bac77b0e0 j-mc-2-obj: init at 126 (#323556)
579d328a9f2fc jetbrains.plugins: fix adding JAR plugins
e23d551fb85c3 postgresqlPackages.pg_partman: 5.1.0 -> 5.2.1 (#361698)
7f9254d7c520c shellhub-agent: 0.16.4 -> 0.17.2 (#362789)
59953c2b3c029 python3: proper syntax for Windows patches (#351010)
b2ad492e00e5a committed: 1.0.20 -> 1.1.2
a43cfd5fc3913 mozillavpn: 2.24.1 -> 2.24.3 (#362717)
87f98369e0d0e haskell.compiler.ghc984: init at 9.8.4
2ec6454a64c3f jbrowse: 2.16.0 -> 2.17.0
3f275c75b831c scip-go: 0.1.21 -> 0.1.22
e8ad7bbf9fe35 geesefs: 0.42.0 -> 0.42.3 (#362480)
d6c3f538eaf73 vesktop: 1.5.3 -> 1.5.4 (#362579)
b6aa74d90282e sozu: 1.0.4 -> 1.0.6
292bd59d3120b json-schema-for-humans: fix build and update
0f18c93b64751 discord: bump all versions (#362751)
2c46e12b8db4a cargonode: refactor
c46abc49f44c1 Merge remote-tracking branch 'upstream/master' into add-cargonode-0.1.2
ffb4e6a4f9f6f doc: fix typo in user mgmt manual page (#362887)
e8eb0137b3664 Merge remote-tracking branch 'upstream/master' into add-cargonode-0.1.2
65484f88b2c21 beets: 2.0.0 -> 2.2.0 (#358086)
5af5ea0a57d13 balena-cli: 19.0.13 -> 20.0.9 (#362520)
28a594a1f08d2 python312Packages.transformers: fix darwin by skipping torch.distributed import (#362768)
22d51a3f2ce00 python312Packages.psd-tools: 1.10.2 -> 1.10.4
c776d4b992799 cargo-deadlinks: move to pkgs/by-name (#362879)
7ee6257cb82e1 cpp-utilities: 5.26.1 -> 5.27.0 (#361910)
8f224ad2ae056 monkeysAudio: 10.81 -> 10.83 (#362048)
39c528fc51839 datadog-agent: 7.50.3 -> 7.56.2 (#358927)
b722c71d05661 emacsPackages.isearch-prop: 0-unstable-2022-12-30 -> 0-unstable-2024-10-13 (#360660)
85b2760359fb5 Fix documentation typo in user mgmt manual page
12d42fb1a4e79 seq66: 0.99.15 -> 0.99.16
44f68a178a142 vscode-extensions.visualjj.visualjj: 0.13.0 -> 0.13.1 (#362881)
e7f4622dae8bb rtabmap: make use of zed-open-capture
6f78b9574e29d zed-open-capture: init at unstable-2023-24-19
f78b15bd0c929 openrisk: add versionCheckHook
f3c8898b76aba vscode-extensions.visualjj.visualjj: 0.13.0 -> 0.13.1
2f1909547fd4e openrisk: format with nixfmt
4e7b5dde83eb4 cloudlist: refactor (#362732)
d4f88d31e2fd2 pekwm: 0.3.0 -> 0.3.1 (#360639)
b6788a4612728 datadog-integrations-core: moderinize derivation
4b9d87c9dbde1 tailwindcss: 3.4.14 -> 3.4.16 (#362557)
036a9a7224d1f cargo-deadlinks: move to pkgs/by-name
86b193aeae271 nixos/github-runners: remove newam from maintainers (#362870)
289a490f068e8 crowdin-cli: 4.3.0 -> 4.4.1
bffe151d39139 tealdeer: move to pkgs/by-name
b7073fc2bd708 nerd-fonts: correct typos in descriptions (#361818)
69fd74d8fe990 nixos/github-runners: remove newam from maintainers
eec12e3d46320 python312Packages.publicsuffixlist: 1.0.2.20241205 -> 1.0.2.20241207 (#362855)
a8f11bf71b6a8 clouddrive2: 0.8.3 -> 0.8.5 (#362834)
d65896287725f open-webui: 0.4.7 -> 0.4.8 (#362849)
a0195def6da70 python312Packages.twentemilieu: 2.1.0 -> 2.2.0
50815eab387a5 python312Packages.yalexs-ble: 2.5.1 -> 2.5.2
e1bdae5eb8c5e xsubfind3r: 0.7.0 -> 0.9.1 (#362714)
9f0e5cf83f22f nerd-fonts: unescape characters in descriptions
e0cb4ace036e8 open-webui: 0.4.7 -> 0.4.8
b5879c104e9e4 krohnkite: 0.9.8.3 -> 0.9.8.4 (#362863)
9c570008cba07 open-webui: add update script
b0cbb2b290207 krohnkite: 0.9.8.3 -> 0.9.8.4
77b46b8745171 python312Packages.ua-parser: 0.18.0 -> 1.0.0 (#360066)
299df5be191b2 spotify-player: 0.20.1 -> 0.20.3
766f5d0f9ef0f pylyzer: 0.0.72 -> 0.0.73 (#362851)
4339c2357c6d5 Bump some vscode extensions (#362805)
4f121f5105db4 timeshift: format expressions and sort dependencies alphabetically (#362740)
9f4607c3c212e atac: 0.18.0 -> 0.18.1
f25c84e18900b ananicy-rules-cachyos: 0-unstable-2024-10-25 -> 0-unstable-2024-11-22 (#362538)
5e95ee4971c98 pylyzer: 0.0.72 -> 0.0.73
ba5c89721048a astyle: 3.6.4 -> 3.6.5 (#362653)
2952abf8b3acd octoscan: 0.1.2 -> 0.1.3
adb17e6bd7da7 python312Packages.py-tes: 0.4.2 -> 1.1.0
1d7a088c34ef2 fflogs: 8.14.21 -> 8.14.49 (#362776)
f6fc80a2275fa flent: convert to unittestCheckHook and add passthru.updateScript (#361633)
f05c2b5b9b745 nhost-cli: 1.27.1 -> 1.28.1
2708bd6c18a1a python312Packages.llama-parse: 0.5.14 -> 0.5.17
615cca5d92037 python312Packages.meilisearch: 0.32.0 -> 0.33.0
06594d056c573 python312Packages.publicsuffixlist: 1.0.2.20241205 -> 1.0.2.20241207
d5d6b1172d604 ollama: 0.4.7 -> 0.5.0 (#362614)
bc33cb627a53b onedrive: patch to fix openssl error (#362601)
f3f364ed3ea5e micropython: 1.24.0 -> 1.24.1 (#362701)
0e1da9a3ead6d plasticity: Fix EGL (#362253)
bcbafe376cdfb tdlib: 1.8.39 -> 1.8.41 (#361732)
1855b17bd52ce jfrog-cli: 2.71.4 -> 2.72.2 (#362276)
c254a9e411041 python312Packages.dm-control: 1.0.25 -> 1.0.26 (#362598)
d8d8b8d9867be julia-bin: autoPatchelf manually to avoid mangling cache
f7ad3137441e3 gruvbox-material-gtk-theme: init at 0-unstable-2024-08-09
216418c0580a0 utm: 4.6.2 -> 4.6.3 (#362650)
f1ca3063b6fb7 sudo-font: 2.0.0 -> 2.1 (#362664)
bdb07962a8d63 cargo-show-asm: 0.2.41 -> 0.2.42 (#362670)
9b05844dc88df onedrive: patch for openssl error
7278930e6d371 sarif-tools: 3.0.2 -> 3.0.4 (#362680)
cd8ac4a1f0df6 python312Packages.weaviate-client: 4.9.4 -> 4.9.6 (#362681)
238644afd5280 stochas: 1.3.12 -> 1.3.13
707b81b5aafa1 phpunit: 11.3.6 -> 11.5.0 (#362673)
f5f3dd8bb3dbe extism-cli: 1.6.0 -> 1.6.1 (#362771)
4860361281738 goawk: 1.28.0 -> 1.29.1 (#362777)
36d26c9a1bdff cargo-udeps: 0.1.52 -> 0.1.53 (#362787)
862152fa8147b python312Packages.knocki: 0.4.1 -> 0.4.2 (#362788)
a88bff43f5ff2 materialize: 0.84.2 -> 0.87.2 (#362138)
6477d7d550e8d gauge-unwrapped: 1.6.9 -> 1.6.10 (#362793)
8cd861ede7a68 electrs: 0.10.6 -> 0.10.7 (#362794)
d78f5d6d1ddf9 xournal: drop (#362376)
502f5c45a8f60 ungoogled-chromium: 131.0.6778.85-1 -> 131.0.6778.108-1
87bd47ac5afc5 chromium: support manually specifying the ungoogled patchset rev in update script
168441ba614d1 clouddrive2: 0.8.3 -> 0.8.5
3dba854b64e61 gut: 0.3.0 -> 0.3.1 (#362743)
7d57af45845d9 nerdfetch: 8.3.0 -> 8.3.1 (#362749)
6f1a1707a8ed2 nwg-panel: 0.9.50 -> 0.9.53 (#362753)
31919cd54eb56 tinymist: 0.12.8 -> 0.12.10 (#362756)
efe99b598c158 ytdl-sub: 2024.11.6 -> 2024.12.4
6e3929dc6b1aa openapi-python-client: 0.21.6 -> 0.21.7 (#362760)
1af5f18824282 zizmor: 0.7.0 -> 0.8.0 (#362761)
f5e5475f93d33 namespace-cli: 0.0.394 -> 0.0.396 (#362762)
f683465105e38 gotrue-supabase: 2.163.2 -> 2.165.1 (#362765)
928556c47148a sonivox: 3.6.13 -> 3.6.14 (#362713)
2d4411860c5bb cargo-hack: 0.6.32 -> 0.6.33 (#362721)
a4a52e803a1ca python312Packages.django-stubs: 5.1.0 -> 5.1.1 (#362723)
b4c443417c34b python312Packages.pylamarzocco: 1.3.2 -> 1.3.3 (#362728)
e1ba30100a81c gersemi: 0.17.0 -> 0.17.1 (#362730)
915d530f7316b pylyzer: 0.0.71 -> 0.0.72 (#362734)
4914254b09cef python312Packages.python-linkplay: 0.0.20 -> 0.1.0 (#362766)
d74fdc89dfe9d video2midi: 0.4.8 -> 0.4.9 (#356869)
22c3f2cf41a0e gqlgenc: 0.25.3 -> 0.27.3 (#362683)
84a5d186bd624 flameshot: 12.1.0-unstable-2024-09-01 -> 12.1.0-unstable-2024-12-03
497022ce84f43 python312Packages.total-connect-client: 2024.5 -> 2024.12 (#362707)
53925e43a54d1 vtm: 0.9.99.35 -> 0.9.99.55 (#362686)
e0f6ddbfa7583 dolt: 1.43.1 -> 1.43.15 (#356838)
8ba573d4a28d9 flarectl: 0.108.0 -> 0.111.0 (#362687)
9fbe0c71361af crd2pulumi: 1.5.3 -> 1.5.4 (#362688)
264ca9185e15d step-ca: 0.28.0 -> 0.28.1 (#362695)
a36d23769156d satellite: 0.5.0 -> 0.9.0 (#362423)
ae0a36e92bf38 conkeyscan: 1.0.0 -> 1.1.0
1eaa9d078a9c8 ocamlPackages.cairo2: 0.6.4 -> 0.6.5 (#354692)
d4c478162a9b5 trueseeing: 2.2.4 -> 2.2.5 (#362700)
eddec41ffa9d0 gatus: 5.13.0 -> 5.13.1 (#362705)
e64c86a67b9cb keymapper: 4.8.2 -> 4.9.0 (#356380)
cda1b025ec85d glycin-loaders: 1.1.1 → 1.1.2
6b024a2b0606e ocamlPackages.containers: 3.14 -> 3.15
e7e2a798acf76 changedetection-io: 0.47.06 -> 0.48.01
347d7e1d88770 ocamlPackages.sel: 0.4.0 -> 0.5.0 (#354268)
009158ef31341 healthchecks: 3.6 -> 3.7 (#356362)
7980727e2c724 bilibili: 1.14.0-2 -> 1.15.2-2 (#362693)
882ff1b923f74 satellite: 0.5.0 -> 0.9.0
6ad564a324d33 satellite: refactor
0dfc95becab47 ocamlPackages.srt: 0.3.0 -> 0.3.1
a33355bee72d4 calibre: format
6b2f6a9734923 erlang-language-platform: 2024-07-16 -> 2024-11-07
6c19ad4943c24 calibre: add image optimization programs
925e6d9f8fb7c keepwn: 0.4 -> 0.5
71f8c356843af schemacrawler: 16.22.2 -> 16.22.3 (#354426)
3b299a3c9ba64 minio: 2024-09-22T00-33-43Z -> 2024-11-07T00-52-20Z
f809e389ddb14 turbovnc: 3.1.2 -> 3.1.3 (#354746)
9ef3e72c29343 pilipalax: init at 1.0.22-beta.12+174 (#360265)
835fa4c61020e python3Packages.pym3u8downloader: init at 0.1.5
b4d58aeade803 python3Packages.pyloggermanager: init at 0.1.4
687d804405f05 topgrade: 16.0.1 -> 16.0.2 (#362804)
78a67786eee4d godspeed: unstable-2021-08-27 -> 1.0
0ba194b1a4e25 nixos/rygel: add package option
fafe46fca0a84 hyprgui: 0.1.9 -> 0.2.0 (#362136)
b56a00b23c3fb pilipalax: init at 1.0.22-beta.12+174
83ef6e599442d check-sieve: init at 0.10
a6efb32b0e9c8 rtkit: fix reduce logging patch URL (#360182)
8bfe42d7e8c9f vscode-extensions.jnoortheen.nix-ide: 0.3.1 -> 0.3.5
72a1655a03dbc filesender: 2.49 -> 2.50 (#353284)
d17b26bc74a5b shogun: disable failing tests (#360883)
c3b0eb39bd97a python312Packages.hvplot: fix checks on darwin (#360891)
dfb0ea1d52c46 vscode-extensions.haskell.haskell: 2.2.2 -> 2.4.4
b89b83eb31162 topgrade: 16.0.1 -> 16.0.2
eb60c8adf1553 atlantis: 0.28.5 -> 0.30.0 (#351913)
3d3c76da9ddfd typstyle: 0.12.7 -> 0.12.8 (#362752)
227594977a1a3 viddy: 1.2.1 -> 1.3.0 (#362506)
63fa51ea8aafe sftpgo: 2.6.2 -> 2.6.3 (#356394)
e2e988d9172b8 gnome-extension-manager: fix black screen via upstream patch (#358236)
ac689cc9b23be cargonode: refactor
1c09ff099b49e paperjam: init at 1.2.1 (#302861)
e0a3e85900757 winetricks: enable darwin support (#360547)
daf879f86913a electrs: 0.10.6 -> 0.10.7
4ddb2d07da656 gauge-unwrapped: 1.6.9 -> 1.6.10
f6a9fc6342880 tree-sitter: update webui fix-paths.patch (#358451)
f31b1ba349692 home-assistant-custom-components.xiaomi_gateway3: 4.0.6 -> 4.0.7
7de05bd2187ec Merge branch 'master' of github.com:xosnrdev/nixpkgs into add-cargonode-0.1.2 pull from master branch
6627bae6a1083 mitra: Init at 3.9.0 (#356298)
1e1fd8ffae11a shellhub-agent: 0.16.4 -> 0.17.2
c7664cac3b7f6 lsb-release: rewrite with `replaceVars`, and use `@runtimeShell@` (#360576)
a5a91987162cc discordchatexporter-cli: support all unix platforms (#360371)
a08d28b565b19 mpd: 0.23.15 -> 0.23.16 (#361649)
ce69bfe9f48ae discordo: 0-unstable-2024-10-13 -> 0-unstable-2024-11-30 (#360894)
62ed7c14489ca python312Packages.knocki: 0.4.1 -> 0.4.2
a6e34ce3c0181 cargo-udeps: 0.1.52 -> 0.1.53
89baa259100cd pingvin-share: 1.4.0 -> 1.6.1 (#361751)
f4fdea6accc91 morewaita-icon-theme: 47.1-> 47.2 (#361807)
f3c3d07d01a1c materialize: 0.84.2 -> 0.87.2
1137de9dc32ae materialize: enable all unix platforms
14944e93bfafb materialize: minor improvements
1433c792295c6 fcitx5-mcbopomofo: 2.8 -> 2.8.1
556a52ac2718b nixos-rebuild-ng: fix linter failures
4b3a232f21c74 yt-dlp: 2024.12.3 -> 2024.12.6 (#362486)
24d6753a349f7 fedifetcher: 7.1.12 -> 7.1.14 (#361994)
1fe9bfe98202e nixos-rebuild-ng: rename manual to nixos-rebuild
e6dc8a3005c08 mongodb-compass: 1.44.4 -> 1.45.0
681949540e64a mongodb-7_0: 7.0.14 -> 7.0.15 (#360828)
c245a07bdae8e mongodb-6_0: 6.0.18 -> 6.0.19 (#360829)
4d3790a2d1691 nerd-fonts: improve alias throw to give example migration (#362769)
93c777ee940fe Fix zygote could not fork error
e9691a4519249 goawk: 1.28.0 -> 1.29.1
c410701f9bc6e fflogs: 8.14.21 -> 8.14.49
e26653680f871 extism-cli: 1.6.0 -> 1.6.1
05f5413f31720 trufflehog: 3.84.2 -> 3.85.0
69590ca7f40bd cups-filters: 1.28.17 -> 2.0.1 (#358724)
8c2f571052c58 nerd-fonts: improve alias throw to give example migration
d842a192cbe0a python312Packages.transformers: fix darwin by skipping torch.distributed import
6dadace420fd5 nixos/wrapper: pass trusted argv[0] to the privileged executable (#285588)
de031293aa0fa flutter_rust_bridge_codegen: init a 2.6.0
e292f2244375c victoriametrics: 1.105.0 -> 1.107.0
9a4f4d4fa99b6 gotrue-supabase: 2.163.2 -> 2.165.1
49952726c3f64 python312Packages.python-linkplay: 0.0.20 -> 0.1.0
e5d0a078a5471 j-mc-2-obj: init at 126
122ae6f0380e5 zizmor: 0.7.0 -> 0.8.0
e321b878c90d7 ttags: 0.4.1 -> 0.4.2 (#362665)
1499755c7d181 namespace-cli: 0.0.394 -> 0.0.396
23bc864ee4684 openapi-python-client: 0.21.6 -> 0.21.7
aa6aa758d63ce typstyle: 0.12.7 -> 0.12.8
90cba9b17d57f tinymist: 0.12.8 -> 0.12.10
a2110386c1e7d discord: bump all versions
386ec507d8677 zizmor: 0.5.0 -> 0.7.0 (#362436)
e3939e1c1fa44 nwg-panel: 0.9.50 -> 0.9.53
fa6caa7153487 chsrc: init at 0.1.9 (#362373)
3042bd00fd3f9 openscad-unstable: 2024-11-18 -> 2024-12-06
3632a79510539 errands: 46.2.6 -> 46.2.7
2c4ec5fd17f37 nerdfetch: 8.3.0 -> 8.3.1
00eccd43797b1 wiki-tui: 0.8.2 -> 0.9.1 (#361843)
30eb636ef38ce slack: 4.41.97 -> 4.41.98
d981560eb517f lazyjournal: init at 0.4.0 (#362539)
0e2e51188d0b3 gut: 0.3.0 -> 0.3.1
d4b0413246396 bilibili: 1.14.0-2 -> 1.15.2-2
b769bf390731a deepin.deepin-movie-reborn: mark as broken
0fb7628e8a186 p3x-onenote: 2024.10.110 -> 2024.10.117
7aad7090b7bd3 nixos/zfs: order pool sync services before final.target
f25c11670721a timeshift: sort dependencies alphabetically
016dac54c5236 terraform-plugin-docs: 0.19.4 -> 0.20.1
c6a09301bdcb2 timeshift: format expressions
c7b6af6e66953 cloudlist: add versionCheckHook
712a80b99bd40 hyprls: 0.2.0 -> 0.3.0
eef600b7720ae pylyzer: 0.0.71 -> 0.0.72
9c144766f0042 cloudlist: format with nixfmt
8e79b2d450a25 chaos: add versionCheckHook
3fea04cafcf86 chaos: add ldflags
2dc8bb0a824bf chaos: format with nixfmt
0ae64adaa91ea xsubfind3r: format with nixfmt
5c8a2cab3f0db nixos/buffyboard: init (#358941)
e7fce9e437ff5 python312Packages.cement: 3.0.10 -> 3.0.12 (#356440)
a1fa8cc852ae2 plasma-panel-spacer-extended: init at 1.9.0 (#335447)
41c7b2a169549 xsubfind3r: format with nixfmt
4b0cdf8b40222 gpxsee: 13.26 -> 13.32 (#362629)
5b52d5397efcb gersemi: 0.17.0 -> 0.17.1
e4cd2a4eec65b python312Packages.globus-sdk: 3.48.0 -> 3.49.0 (#362405)
12fc38284352e python312Packages.homematicip: 1.1.3 -> 1.1.4
e398a97f73b52 python312Packages.pylamarzocco: 1.3.2 -> 1.3.3
bbd314463df32 python312Packages.cement: disable tests on Darwin
84225e0e3594d scarab: 2.5.0.0 -> 2.6.0.0
508a791f9ef75 awsebcli: update override for cement
e1eb67dc93120 python312Packages.cement: 3.0.10 -> 3.0.12
2ee977f38fd4c ad-miner: 1.6.1 -> 1.7.0 (#362600)
b97609f0febf1 python39: 3.9.20 -> 3.9.21; python310: 3.10.15 -> 3.10.16 (#362261)
db8f4f4e59134 epic5: 3.0.1 -> 3.0.2 (#362334)
2d036d3a649a0 lima: 1.0.1 -> 1.0.2 and add version test (#361378)
020924cb8b423 sopwith: 2.6.0 -> 2.7.0
83dbd3e7fb988 python312Packages.django-stubs: 5.1.0 -> 5.1.1
d05b3108965a5 python312Packages.tensorflow-metadata: 1.15.0 -> 1.16.1 (#358589)
ff797c2bf62fc lix: only use LTO with GCC (#353576)
f0494f9e82e4a cargo-hack: 0.6.32 -> 0.6.33
d2a665f7c6af5 python312Packages.ihm: 1.7 -> 1.8 (#362422)
54e82959ac592 python312Packages.datalad: 1.1.3 -> 1.1.4 (#357153)
0ed508a1ca2a6 python312Packages.dm-haiku: 0.0.12 -> 0.0.13 (#360346)
148792b088869 python312Packages.itemadapter: 0.9.0 -> 0.10.0 (#360148)
6e27a49de18a5 python312Packages.optimum: 1.23.0 -> 1.23.3 (#360128)
5600911ee8698 python312Packages.scikit-posthocs: 0.9.1 -> 0.11.0 (#359913)
841a952de1397 python312Packages.tensorflow-metadata: 1.15.0 -> 1.16.1
2b2be7e4ef978 python312Packages.tinydb: 4.8.0 -> 4.8.2 (#359124)
8028c0ca4012d python312Packages.art: 6.3 -> 6.4 (#359512)
e032f6ca46ade mlflow-server: 2.17.2 -> 2.18.0 (#359546)
9fd6755173f3e commitizen: 3.30.0 -> 4.0.0 (#359650)
e949cb33cef2e eksctl: 0.194.0 -> 0.197.0 (#362174)
abba89a3ec92d python312Packages.marimo: 0.9.14 -> 0.9.27 (#359698)
5a4f44dd31e7f python312Packages.scikit-posthocs: 0.9.1 -> 0.11.0
ce9e1e9d6ab77 minijinja: 2.4.0 -> 2.5.0 (#362666)
c97ad4346b9f1 python312Packages.langsmith: 0.1.137 -> 0.1.147 (#359993)
745a890dbdd7c nixos/hostapd: remove HT40- from default capabilities (#362677)
63dcaf4badb13 mozillavpn: 2.24.1 -> 2.24.3
8d612848f98f7 python312Packages.rdflib: 7.0.0 -> 7.1.1 (#360380)
6d2395e8c6dbc python312Packages.itemadapter: 0.9.0 -> 0.10.0
e05c734f9248d ndcurves: 1.4.1 -> 2.0.0 (#362263)
1d01648393d82 python312Packages.replicate: 1.0.1 -> 1.0.4 (#360250)
379aeabd483df python312Packages.dm-haiku: 0.0.12 -> 0.0.13
564a8d3d0e40f dbeaver-bin: 24.2.3 -> 24.3.0 (#362563)
268bc0de7a50a python312Packages.django-import-export: 4.1.1 -> 4.3.3 (#362409)
8e413c45338d3 python312Packages.sphinxcontrib-confluencebuilder: 2.7.1 -> 2.9.0 (#360513)
8c6400ff8377b bazel-gazelle: 0.39.1 -> 0.40.0
daf0295d630ae xsubfind3r: 0.7.0 -> 0.9.1
9da738ea18e63 sonivox: 3.6.13 -> 3.6.14
3dcd875c9a362 cot: fixes for python312 (#362256)
51da93207ee52 python312Packages.rdflib: use default pytestCheckHook
0290856af4e05 python312Packages.total-connect-client: 2024.5 -> 2024.12
3d73d05791873 time: fix implicit function declaration (#362226)
9ded9ca8eb4d0 python312Packages.rdflib: 7.0.0 -> 7.1.1
25261a0199d65 harbor-cli: 0.0.1 -> 0.0.2
be4a655cf2e32 modules/avahi: Enable IPv6 by default (#361016)
5714c33244540 python312Packages.sphinxcontrib-confluencebuilder: 2.7.1 -> 2.9.0
3d7bcbb8105ae gatus: 5.13.0 -> 5.13.1
a146b20e543fc python312Packages.gsd: 3.4.0 -> 3.4.2 (#360536)
6b7dea8d87151 peazip: 10.0.0 -> 10.1.0
29b647f5c57d2 micropython: 1.24.0 -> 1.24.1
d3bcad147bd63 weaver: 0.10.0 -> 0.11.0 (#362378)
1a78b859f3594 pytr: 0.3.0 -> 0.3.1 (#362512)
7053f294538be trueseeing: 2.2.4 -> 2.2.5
8e58a34739caa pyspread: 2.3 -> 2.3.1
8d180bf83cdb6 opentelemetry-collector-builder: 0.114.0 -> 0.115.0
940b0e9a7123d uxn: 1.0-unstable-2024-10-19 -> 1.0-unstable-2024-11-30
dc6b8fa2ed1ae step-ca: 0.28.0 -> 0.28.1
4b40dbcf8e93a abcmidi: 2024.10.10 -> 2024.12.06 (#362402)
45691701c3810 pam: Use freebsd.pam on FreeBSD
117edf2f5cb9b firebase-tools: 13.20.2 -> 13.28.0
21cf8f9842d66 crd2pulumi: 1.5.3 -> 1.5.4
d5f8109306590 flarectl: 0.108.0 -> 0.111.0
a043000373a5b vtm: 0.9.99.35 -> 0.9.99.55
486f034b93f34 lefthook: 1.8.1 -> 1.9.0
41331ec50715b gqlgenc: 0.25.3 -> 0.27.3
762a740b7bda4 python312Packages.weaviate-client: 4.9.4 -> 4.9.6
d680ca289f88b sarif-tools: 3.0.2 -> 3.0.4
0abc80da7fccf chromium: remove ofborg maintainer ping workaround, use CODEOWNERS (#362543)
5d4235a89765e onedrive: patch hardcoded paths (#362646)
8a97d662ddc24 nixos/hostapd: remove HT40- from default capabilities
c77b49d099d05 treewide: Remove obsolete workaround for fetchCargoTarball (#362570)
2c9d2c73051a8 simulide: correct version definition
f3cac64f4d786 phpunit: 11.3.6 -> 11.5.0
03ad72a502432 qtscrcpy: 2.2.1 -> 3.0.0 (#362639)
cfc9a8a555f6d cargo-show-asm: 0.2.41 -> 0.2.42
acdbfffd07896 scrcpy: 3.0 -> 3.0.2 (#361943)
45fe26aaf8847 minijinja: 2.4.0 -> 2.5.0
af6d0825caa50 ttags: 0.4.1 -> 0.4.2
b139d3d874d24 vulkan-hdr-layer-kwin6: init at 0-unstable-2024-10-19 (#345805)
56e8788c8ab6f sudo-font: 2.0.0 -> 2.1
7ae4990c0f45d glooctl: 1.17.14 -> 1.17.16 (#356321)
495c41bcf2b3c jbang: 0.119.0 -> 0.120.4 (#356507)
8f2d4850fab0a renode-unstable: 1.15.3+20241004git4b8a8f170 -> 1.15.3+20241112git6e850cb52 (#356066)
a684bc7c1994a passt: 2024_09_06.6b38f07 -> 2024_10_30.ee7d0b6 (#356031)
b587256246d2a boogie: 3.2.5 -> 3.4.2 (#356053)
4d5a42681aacd wormhole-william: install shell completions
9bc50feb3b271 utm: 4.6.2 -> 4.6.3
995bd7643cd73 mint-l-theme: 1.9.8 -> 1.9.9 (#362638)
8a8487fc1b7fd python312Packages.pybids: 0.17.2 -> 0.18.1
d2428f7e442e2 onedrive: patch missed paths
b43c292077a5f lisp-modules: detect circular dependencies during quicklisp import
a86e263b9538f gimpPlugins.gap: mark as linux-only
a7140ff3f0945 gimpPlugins.gap: fix aarch64-linux build
448b2e3a7518a gimpPlugins.bimp: fix darwin build
3b33901cff7b9 terraform-providers.archive: 2.6.0 -> 2.7.0
67bb33e820f1e astyle: 3.6.4 -> 3.6.5
e99f4a48af9d3 devbox: 0.13.6 -> 0.13.7
b630bc0d382f2 dosbox-x: 2024.10.01 -> 2024.12.04 (#362072)
5d45a500ce076 qtscrcpy: 2.2.1 -> 3.0.0
182d43877a98b python312Packages.aioesphomeapi: 27.0.1 -> 28.0.0 (#362603)
208dc586487e2 python312Packages.sigstore-rekor-types: 0.0.13 -> 0.0.17 (#357817)
3e191c86b4b0c mint-l-theme: 1.9.8 -> 1.9.9
016f2d04c705c python312Packages.hass-nabucasa: 0.83.0 -> 0.86.0 (#362602)
161e50c6df7e4 python312Packages.mypy-boto3-s3: 1.35.74 -> 1.35.76 (#362632)
e889fb97d0642 python312Packages.sigstore: 3.5.1 -> 3.5.3
b79e67eb64400 python312Packages.sigstore-rekor-types: 0.0.13 -> 0.0.17
ecbf38cf9a27d cargo-temp: 0.2.22 -> 0.3.0
ced979000abcf python312Packages.securesystemslib: 1.1.0 -> 1.2.0 (#362633)
23e35ed93db4f mir: 2.18.3 -> 2.19.2 (#362220)
6f8499541f5a6 python312Packages.snowflake-connector-python: 3.12.3 -> 3.12.4 (#362479)
d530a7b9eaf03 nixos/lemmy: fix nginx backend to proxy needed headers (#306984)
7f4bcf7c815a2 anki: enable tests that are now fixed
f2ad5d4aeec43 python312Packages.pylamarzocco: 1.2.11 -> 1.3.2 (#362631)
f0ca7ba5581e0 python312Packages.securesystemslib: 1.1.0 -> 1.2.0
6ffd3875ca39e python312Packages.pontos: 24.9.0 -> 24.12.0 (#362610)
b4cc970bbc3bf python312Packages.aiortm: 0.9.38 -> 0.9.42 (#362604)
da35ecb61a166 python312Packages.aioopenexchangerates: 0.6.17 -> 0.6.18 (#362605)
0cd3f9ed019ed python312Packages.autoslot: 2022.12.1 -> 2024.12.1 (#362607)
2419bcfb3b925 python312Packages.asyncmy: 0.2.9 -> 0.2.10 (#362606)
046006262e07c python312Packages.fastcore: 1.7.22 -> 1.7.23 (#362608)
ef6387426a56f python312Packages.openrgb-python: 0.3.2 -> 0.3.3 (#362611)
67e9d204169b4 python312Packages.id: 1.4.0 -> 1.5.0 (#362612)
30a17658ac99c python312Packages.mypy-boto3-s3: 1.35.74 -> 1.35.76
501614a768249 python312Packages.weconnect: 0.60.5 -> 0.60.6 (#362615)
c90e086ba3193 containerlab: 0.59.0 -> 0.60.0 (#362284)
8c933f4d02b86 python312Packages.llama-index-core: 0.11.23 -> 0.12.1 (#357838)
0631a11eede03 python312Packages.pylamarzocco: 1.2.11 -> 1.3.2
05435f152ee63 mangayomi: 0.3.75 -> 0.3.8
36f4e01add1e7 gpxsee: 13.26 -> 13.32
30bdd1f9a05f1 python312Packages.pylamarzocco: 1.2.3 -> 1.2.11 (#359450)
093b0011a26c6 poetry: 1.8.4 -> 1.8.5
6b32ff9916668 python312Packages.pkginfo: 1.11.1 -> 1.12.0
ed65078227d93 python312Packages.llama-cloud: 0.1.5 -> 0.1.6
190e90e9fe150 python312Packages.llama-index-question-gen-openai: 0.2.0 -> 0.3.0
f94c54447acf2 python312Packages.llama-index-embeddings-ollama: relax ollama
e9a51c43beeb1 python312Packages.llama-index-program-openai: 0.2.0 -> 0.3.1
efe65ae5063ee python312Packages.llama-index-readers-s3: 0.3.0 -> 0.4.0
ada1261254f08 python312Packages.llama-index-llms-openai-like: 0.2.0 -> 0.3.0
250f38e1d63a6 python312Packages.llama-index-agent-openai: 0.3.4 -> 0.4.0
e91b0011816f8 python312Packages.llama-index-multi-modal-llms-openai: 0.2.3 -> 0.3.0
5eef17f8999e2 python312Packages.llama-index-llms-openai: 0.3.1 -> 0.3.2
0e0f7788233d9 python312Packages.llama-index-indices-managed-llama-cloud: 0.6.2 -> 0.6.3
4e8789601f3b8 python312Packages.llama-index-llms-ollama: 0.4.0 -> 0.4.1
7fed8724d2f9f python312Packages.llama-index-vector-stores-postgres: 0.3.0 -> 0.3.2
501ebee47f162 python312Packages.llama-index-cli: 0.3.1 -> 0.4.0
e95e2179ee848 python312Packages.llama-index-core: 0.12.1 -> 0.12.2
66e137cacffc2 python312Packages.llama-index-embeddings-gemini: 0.2.2 -> 0.3.0
b9790e52bd954 python312Packages.llama-index-embeddings-google: 0.2.1 -> 0.3.0
10196932892f8 python312Packages.llama-index-embeddings-huggingface: 0.3.1 -> 0.4.0
6fee9b2698265 python312Packages.llama-index-embeddings-ollama: 0.3.1 -> 0.4.0
de3d7e1b7b60a python312Packages.llama-index-embeddings-openai: 0.2.5 -> 0.3.0
6b69c4f77a59f python312Packages.llama-index-graph-stores-nebula: 0.3.0 -> 0.4.0
11f3a49b2bf97 python312Packages.llama-index-graph-stores-neo4j: 0.3.5 -> 0.4.0
770be765cf920 python312Packages.llama-index-graph-stores-neptune: 0.2.2 -> 0.3.0
c2b4b6f877ae6 python312Packages.llama-index-indices-managed-llama-cloud: 0.4.0 -> 0.6.2
445745b737957 python312Packages.llama-index-llms-ollama: 0.3.6 -> 0.4.0
931ddfd2ae9c4 python312Packages.llama-index-llms-openai: 0.2.16 -> 0.3.1
f0f1aca558b6e python312Packages.llama-index-readers-database: 0.2.0 -> 0.3.0
32fd961b84fe1 python312Packages.llama-index-readers-file: 0.3.0 -> 0.4.0
0ca5eccb31978 python312Packages.llama-index-readers-json: 0.2.0 -> 0.3.0
5eccc27f85fc5 python312Packages.llama-index-readers-llama-parse: 0.3.0 -> 0.4.0
9917a494deec3 python312Packages.llama-index-readers-twitter: 0.2.0 -> 0.3.0
25495a31da447 python312Packages.llama-index-readers-txtai: 0.2.0 -> 0.3.0
7ac3e82e7f293 python312Packages.llama-index-readers-weather: 0.2.0 -> 0.3.0
0767499134224 python312Packages.llama-index-vector-stores-chroma: 0.3.0 -> 0.4.0
626b683a7123e python312Packages.chromadb: 0.5.18 -> 0.5.20
59bcfab931ed4 python312Packages.llama-index-vector-stores-google: 0.2.0 -> 0.3.0
0fe6cbc6facf1 python312Packages.llama-index-vector-stores-postgres: 0.2.6 -> 0.3.0
bd7864fb6cc62 python312Packages.llama-index-vector-stores-qdrant: 0.3.3 -> 0.4.0
6abf35936b466 python312Packages.llama-index-core: 0.11.23 -> 0.12.1
301b8fe9acddd python312Packages.llama-cloud: 0.1.4 -> 0.1.5
411d15dc68efe python312Packages.weconnect: 0.60.5 -> 0.60.6
29313f73725ee openjph: 0.17.0 -> 0.18.1
cd580da23a417 collector: 0-unstable-2024-08-02 -> 0-unstable-2024-11-11
d1caef8c5b775 python312Packages.id: 1.4.0 -> 1.5.0
b0fed75a83288 python312Packages.pontos: 24.9.0 -> 24.12.0
de0efdf77900f python312Packages.openrgb-python: 0.3.2 -> 0.3.3
cc2454d93246a python312Packages.fastcore: 1.7.22 -> 1.7.23
612abc0c67830 python312Packages.autoslot: refactor
0d02317114092 python312Packages.autoslot: 2022.12.1 -> 2024.12.1
2d3107bd028f9 python312Packages.asyncmy: 0.2.9 -> 0.2.10
291591157d1e4 python312Packages.aiortm: 0.9.38 -> 0.9.42
cc6febd78974a python312Packages.aioopenexchangerates: 0.6.17 -> 0.6.18
a01ee2f7f3e0f terraform-providers.spacelift: 1.16.1 -> 1.19.0
ab29891a1995d terraform-providers.incus: 0.1.4 -> 0.2.0
4c0bbe324e862 terraform-providers.hcloud: 1.48.1 -> 1.49.1
11b9fa49b9849 home-assistant-custom-lovelace-modules.vacuum-card: init at 2.10.1 (#357070)
2943e975f3c29 python312Packages.aioesphomeapi: 27.0.1 -> 28.0.0
f1426205cee60 python312Packages.hass-nabucasa: 0.83.0 -> 0.86.0
ff1502b97d890 chsrc: init at 0.1.9
7a625d3ccf9b0 nixos/wivrn: add server flags option and refactor type check
70428ae6fcba4 home-assistant-custom-components.homematicip_local: 1.72.0 -> 1.73.0 (#362593)
87ae7fe2470d3 wivrn: 0.19 -> 0.22
1426c2534a721 checkov: 3.2.330 -> 3.2.332 (#362510)
87afc37a197e7 python312Packages.velbus-aio: 2024.10.0 -> 2024.11.1 (#362509)
ba1e58ddc81b6 python312Packages.dm-control: 1.0.25 -> 1.0.26
015328399ec73 home-assistant-custom-lovelace-modules.vacuum-card: init at 2.10.1
7e48fbbcad453 yara-x: 0.11.0 -> 0.11.1
da61cc23b502e ad-miner: 1.6.1 -> 1.7.0
2a5ea0028078f pnpm: 9.14.4 -> 9.15.0 (#362450)
627b07c9308d1 python312Packages.huggingface-hub: 0.26.3 -> 0.26.5
388fb86793c8a amdvlk: 2024.Q3.3 -> 2024.Q4.1 (#359068)
7e81a7f76dc14 home-assistant-custom-components.homematicip_local: 1.72.0 -> 1.73.0
05c78a8045d67 python312Packages.hahomematic: 2024.11.8 -> 2024.12.0
87cf5a7957e86 python312Packages.pyiceberg: init at 0.8.1
672b3f89455b5 nixos/bazecor: init
94f4b235d85ff python312Packages.posthog: 3.7.0 -> 3.7.4 (#362519)
6cdb99fb6222e bazecor: 1.5.4 -> 1.6.1
d4eb00756569c python312Packages.transformers: 4.46.3 -> 4.47.0 (#362247)
a4f09cbbf59a0 lomiri.lomiri-mediaplayer-app: init at 1.1.0 (#359708)
60ea1e34e590b gnome-secrets: 9.6 -> 10.3
77962d4e31e51 linuxKernel.kernels.linux_zen: 6.12.1-zen1 -> 6.12.2-zen1; linuxKernel.kernels.linux_lqx: 6.12.1-lqx1 -> 6.12.2-lqx3 (#362258)
fa58ce6381183 palemoon-bin: 33.4.1 -> 33.5.0 (#362141)
59f6a88d37481 ollama: 0.4.7 -> 0.5.0
ff32f66b32a07 python312Packages.rapidocr-onnxruntime: 1.3.24 -> 1.4.1
f0b23f7d01f02 xournalpp: 1.2.4 -> 1.2.5 (#362382)
719009450e92a docker-init: v1.3.0 -> v1.4.0 (#362386)
a61c5e4851f0b rustic: 0.9.4 -> 0.9.5
100f49fed4688 dnsvalidator: init at 0.1-unstable-2023-01-17
5d029a72b3ac5 sile: mark broken on darwin
5edc28dbabaae sile: drop obsolete workaround for fetchCargoTarball triggering configure
5017d41238526 git-warp-time: drop obsolete workaround for fetchCargoTarball triggering configure
9bde82f503b18 decasify: drop obsolete workaround for fetchCargoTarball triggering configure
82ab56b33201e nixos/locate: update hardening from upstream (#362126)
4a62c98471491 dotnet: fix packages that fail to build with strictDeps (#362420)
ced9c85be3043 gh-copilot: 1.0.1 -> 1.0.5
dd7d0b79b508f dbeaver-bin: 24.2.3 -> 24.3.0
938d142c35d03 unrar: 7.1.1 -> 7.1.2 (#362070)
e157e54d4d1c2 code-cursor: 0.43.0 -> 0.43.6
14c2813bd7429 tailwindcss: 3.4.14 -> 3.4.16
5ee7b3912f5c9 vimPlugins.blink-cmp: 0.7.1 -> 0.7.3 (#362468)
cc899859d834a pocketbase: 0.23.1 -> 0.23.4
08f55a8c723e0 raycast: 1.87.2 -> 1.87.4 (#362102)
08c3c0c0bf2f1 gpxlab: add symlink to binary on darwin, migrate to by-name (#358684)
992e5d075b518 pmtiles: 1.22.1 -> 1.22.2 (#362482)
5edab6395f0d7 gitu: 0.26.0 -> 0.27.0 (#362478)
674835a9d98fd chromium: remove ofborg maintainer ping workaround, use CODEOWNERS
96df5142416ca lazyjournal: init at 0.4.0
e6199124df8e7 buildFHSEnvBubblewrap: set meta.mainProgram
40c579ca29d3a buildFHSEnvBubblewrap: format default.nix
23211d6b59d89 python3Packages.django-mfa3: Enable failing test
a4b5b5f89dd51 linux_xanmod_latest: 6.11.10 -> 6.11.11
c55d81a2ef622 orbiton: 2.68.2 -> 2.68.4 (#362518)
93a5e4a31a80a sonarr: 4.0.10.2544 -> 4.0.11.2680
0bbfbc0b4395b dotnet: wrapper improvements (#362425)
3e4ce66fe0e28 python312Packages.scalene: 1.5.47 -> 1.5.49
a8f699a5730ad komikku: 1.64.0 -> 1.65.0 (#362524)
88f9f6f54e678 signal-desktop: 7.34.0 -> 7.35.0 (#361881)
fd39bbae626b4 chocolate-doom: 3.0.1 -> 3.1.0 (#361411)
d45d4a2aa7356 libratbag: 0.17 -> 0.18; piper: 0.7 -> 0.8 (#345782)
e8961d9e65ce5 nixos/prometheus: add mqtt-exporter (#289395)
166af0392765e python3Packages.django: fix build on 32 bit platforms (#353399)
4b5e02043f696 nixos/archisteamfarm: add mincore to SystemCallFilter
76eabd18069ef proxmox-auto-install-assistant: 8.2.6 -> 8.3.3 (#358939)
345d36a3e58a5 nixos/prometheus-mqtt-exporter: add release notes entry
efbb8bd904546 nixos/tests/prometheus-exporters: add tests for mqtt-exporter
2acc732b6a1db nixos/prometheus: add mqtt-exporter
1489d59ba0c20 waybar: add option for en-/disabling niri support (#361152)
7de803c703a15 minio-warp: init at 1.0.6 (#359607)
719cdf08a5fc9 openresty: make postgres module optional (#362426)
d5c7eaec3ba65 vsce/python: fix `pythonUseFixed` (#362323)
b3eca67865e2a nixos/openresty: fix build with nginx modules (#362348)
4b8b05c2e0d49 rosegarden:  22.12.1 -> 24.12 (#362427)
f341d4efa26e8 signalbackup-tools: 20241119 -> 20241205 (#361203)
54c06b3aa66af vtfedit: init at 1.3.3
aa9d02b5a1dd1 python312Packages.pycrdt: 0.10.7 -> 0.10.8 (#362488)
5627b82bfb402 pkgsite: init at 0-unstable-2024-12-06
7c4b748f98fe2 rtorrent: use vendored tinyxml2 for XMLRPC (#362158)
e0431c7d4f74d tcount: init at 0-unstable-2023-04-20
ab7512fbba738 git-town: 16.4.1 -> 16.7.0
b19376407d07e balena-cli: 19.0.13 -> 20.0.9
206ea9fae6ae1 signalbackup-tools: 20241119 -> 20241205
1b7d1024fbf66 orbiton: 2.68.2 -> 2.68.4
3b3d38924b441 ankama-launcher: 3.12.24 -> 3.12.26
2ea653e5689c9 python312Packages.posthog: 3.7.0 -> 3.7.4
6cedd792b1d02 prisma: 5.22.0 -> 6.0.1
733c49cda479c prisma-engines: 5.22.0 -> 6.0.1
a4f40e4a28676 python312Packages.velbus-aio: 2024.10.0 -> 2024.11.1
cb51162e00dbc pytr: 0.3.0 -> 0.3.1
a5f52e17341ca checkov: 3.2.330 -> 3.2.332
c6b810292b497 viddy: 1.2.1 -> 1.3.0
f145dbde156ef timeshift: 24.06.3 -> 24.06.5 (#362439)
89eb0f62750de villain: 2.2.0 -> 2.2.1 (#362428)
3df575831c205 opengist: 1.7.5 -> 1.8.3 (#354830)
921d4010265db jfrog-cli: 2.71.4 -> 2.72.2
d6b812546b521 gnat-bootstrap: fix and enable strictDeps (#361717)
cc7d5fc95a5e6 home-assistant-custom-components.solis-sensor: 3.7.1 -> 3.7.2 (#362440)
6b2892c47ef0e Revert "splice.nix: make `pkgs` `splicedPackages`" (#362496)
8a1be565fc42a amdvlk: 2024.Q4.1.3 -> 2024.Q4.2
9d9f4b50b446c Revert "splice.nix: make `pkgs` `splicedPackages`"
2463134e4cfcf wget: fix and enable strictDeps (#361823)
c122883ba8dcc codeberg-cli: 0.4.3 -> 0.4.6 (#362204)
3cb2fa6e00145 vagrant: 2.4.1 -> 2.4.3
d7f97a0223589 vulkan-caps-viewer: 3.43 -> 4.00 (#362459)
debf997987df5 splice.nix: make `pkgs` `splicedPackages` (#349316)
fd2d8e30cad84 dotnet: december 2024 update (#362191)
fe76ffc48a47c python312Packages.pycrdt: 0.10.7 -> 0.10.8
d7873e29680db rygel: remove unused gtk3 buildInputs (#362483)
d871680fc4465 knot-dns: 3.4.2 -> 3.4.3 (#362403)
ff688dd2b2d4e jujutsu: 0.23.0 -> 0.24.0
07cb36c3f9ce6 yt-dlp: 2024.12.3 -> 2024.12.6
f2e100dfc1e14 rygel: remove unused gtk3 buildInputs
4c4b9f09be7c9 zulip: expand platforms to all Linux (#362474)
2c8a792facf48 immich: 1.121.0 -> 1.122.1
1becf6e0dabfa ci: add mergify rules for nixpkgs (#360340)
32e4542ae6197 python312Packages.minio: 7.2.10 -> 7.2.12
8aa33662633f8 ci: add Nixpkgs lib-tests workflow (#361447)
f9175022d61a8 update-python-libraries: migrate git revs to tag (#362222)
c1b7fa8153b6d parallel: fix strictDeps (#362116)
7bdb5641a3b81 pmtiles: 1.22.1 -> 1.22.2
d6b6d8c37d422 google-chrome: 131.0.6778.85 -> 131.0.6778.108 (#362451)
66e1587207678 geesefs: 0.42.0 -> 0.42.3
adf2b41bfc590 gitu: 0.26.0 -> 0.27.0
b5c0139ca0dba python312Packages.snowflake-connector-python: 3.12.3 -> 3.12.4
7c1aca7140497 checkov: use default python (3.12) (#361733)
0965248341630 gvproxy: 0.8.0 -> 0.8.1
29d7565e1bf51 zulip: expand platforms to all Linux
a0ad081b9fc57 fluxus, racket_7_9: drop (#362330)
db607a647be64 nixos/cage: add package option (#359057)
a3fbadd7538b1 vimPlugins.blink-cmp: 0.7.1 -> 0.7.3
794630183a8a1 mlton: enable aarch64-darwin (#302487)
3aa821cdb3273 intel-compute-runtime: 24.39.31294.12 -> 24.45.31740.9 (#362374)
bff87365df805 lua-language-server: 3.13.2 -> 3.13.3 (#362390)
8695054aeeb98 gcalcli: 4.4.0 -> 4.5.1 (#352984)
f0fae9fc6b3e3 k9s: 0.32.6 -> 0.32.7 (#360993)
e690cce817d1a vulkan-caps-viewer: 3.43 -> 4.00
19941080a53b6 k0sctl: 0.19.2 -> 0.19.4 (#362418)
7354b62568e2b google-chrome: 131.0.6778.85 -> 131.0.6778.108
863cbb3c69088 rygel: make gtk support optional (#355937)
31fd6bfe49440 python312Packages.samsungtvws: 2.7.0 -> 2.7.2 (#362397)
b8e97a46eb4d7 gifski: move to by-name, use `useFetchCargoVendor` (#356968)
b59e28cd3cfb7 pnpm: 9.14.4 -> 9.15.0
10f4df2612931 simulide: migrate to pkgs/by-name (#359552)
d9d8de01960f1 warp-terminal: 0.2024.11.19.08.02.stable_03 -> 0.2024.12.03.08.02.stable_04 (#362298)
d22e55da7ee5c maintainers: update GitHub names (#362419)
889fd9b4c4ded s2geometry: enable on unix (#357688)
510e9307a054a delly: 1.3.1 -> 1.3.2 (#362400)
2876f99354733 oras: 1.2.0 -> 1.2.1 (#362395)
ca71b090cec23 oxker: 0.8.0 -> 0.9.0 (#362393)
bb2beebab3aac opnborg: 0.1.24 -> 0.1.44
4b8dd3f6d7c0d vkquake: 1.31.2 -> 1.31.3 (#354942)
eb3630761b9f6 cnspec: 11.33.0 -> 11.33.1 (#362392)
deb0f4238b313 prometheus-knot-exporter: 3.4.2 -> 3.4.3
0e55ef679161f zfs-replicate: 3.2.13 -> 4.0.0 (#358841)
f1c12935ad8f1 python312Packages.libknot: 3.4.2 -> 3.4.3
ce10e484bb834 cargo-sort: 1.0.9 -> 1.1.0 (#362362)
fe465a1c28cd8 apptainer, singularity: fix the update instructions in the comment (#359528)
6c23e1a5613f2 gotemplate: 3.11.0 -> 3.12.0 (#362249)
183a1fe0696ce mediainfo-gui: Fix missing GSettings schemas (#359367)
7ad421a9a998a home-assistant-custom-components.solis-sensor: 3.7.1 -> 3.7.2
f0b484fb06a0b protonvpn-gui: 4.7.4 -> 4.8.0 (#359877)
6f15fbd6b1c38 python3Packages.blake3: 0.4.1 -> 1.0.0 (#360435)
ab8c8edc97d64 foomatic-db: 0-unstable-2024-08-13 -> 0-unstable-2024-12-05
3195f07888455 foomatic-db*: add leading digit to version attribute
123a31096fc2c firefly-iii: fix typo (#360434)
9127655f5e472 rustPlatform.fetchCargoTarball: dontConfigure (by default) (#360540)
2ab6f6d616308 twig-language-server: 0.5.1 -> 0.6.0 (#362290)
1877695fd2430 mendeley: 2.122.1 -> 2.127.1 (#362303)
1b59a4564376e zizmor: 0.5.0 -> 0.7.0
cb1396b74e01d python312Packages.qtile-bonsai: init at 0.4.0 (#356700)
24e5f39987204 release-plz: 0.3.98 -> 0.3.110 (#362124)
643c68fc8e4de cargo-deb: 2.7.0 -> 2.9.1 (#362123)
f9224197450fa flent: Add passthru.updateScript
57fc5be4a6160 flent: Convert to unittestCheckHook
f28ecbe89ad90 lima: prefer version testing in installCheckPhase rather than passthru.tests.version
826ce5a8f2e52 ksmbd-tools: 3.5.2 -> 3.5.3 (#362077)
b59eb3364e8ce di: 4.54 -> 4.54.0.1 (#362059)
9b45c39cecf8e emacsPackages.ebuild-mode: 1.75 -> 1.76 (#362049)
5575fca857776 redocly: 1.25.9 -> 1.25.11 (#362058)
d2de853317bf1 vips: 8.15.5 -> 8.16.0
fe04f12dd0840 python312Packages.django-admin-datta: 1.0.11 -> 1.0.15 (#361968)
6ac1bd2978dc4 garnet: 1.0.39 -> 1.0.46 (#361658)
e36bbe793ec5a lock: 1.2.0 -> 1.3.0 (#361663)
30928d42d90b0 treesheets: 0-unstable-2024-09-08 -> 0-unstable-2024-11-24 (#359801)
faa59aa55a42c cni-plugins: 1.6.0 -> 1.6.1 (#362047)
8682a88957421 gitlab-release-cli: 0.19.0 -> 0.20.0 (#362387)
74eae6a8b48c3 nixos/cinnamon: Add x-cinnamon-mimeapps.list
f0ea6d083f3ac bore-cli: 0.5.1 -> 0.5.2 (#362255)
73405c08ca81e phpExtensions.blackfire: 1.92.28 -> 1.92.29 (#362269)
c7c110e9a938f python312Packages.sip: 6.8.6 -> 6.9.0 (#362184)
cb4fa6a8044c7 python312Packages.pyqt-builder: 1.16.4 -> 1.17.0 (#362187)
f6bdeca7a72b7 python312Packages.ihm: 1.7 -> 1.8
608bb54d5005f witness: 0.6.0 -> 0.7.0 (#362275)
3c6bcb59656ee python312Packages.molecule: 24.9.0 -> 24.12.0 (#362282)
0846466411b94 screenfetch: 3.9.1 -> 3.9.9 (#361850)
81ab50ae91c38 python312Packages.django-import-export: 4.1.1 -> 4.3.3
b862828a8feb5 python312Packages.cvelib: 1.6.0 -> 1.7.0 (#362286)
cb6b8cf536f63 hurl: 5.0.1 -> 6.0.0 (#361938)
a560959b1d0a5 hfst-ospell: 0.5.3 -> 0.5.4 (#361979)
38b5139ea0856 villain: 2.2.0 -> 2.2.1
a4bfd6200f2c5 proton-pass: 1.24.1 -> 1.25.0 (#362125)
91fe162f69988 rosegarden: move to pkgs/by-name
7d4576b814746 timeshift: fix meta.longDescription (the wrapper part)
85dae69cb7061 raspberrypifw: 1.20240926 -> 1.20241008 (#351605)
20fc90dd72c66 fwupd: 2.0.2 -> 2.0.3 (#362399)
f924e6357195a rosegarden: format with nixfmt
3e65feb9c7e15 rosegarden: 22.12.1 -> 24.12 changelog: https://rosegardenmusic.com/wiki/dev:24.12
74fc7ef8c2f9f timeshift: 24.06.3 -> 24.06.5
791b829b32ddc dotnetCorePackages.combinePackages: use wrapper
895b69405c103 dotnet: make wrappers usable as DOTNET_ROOT
cb29290646fd4 openresty: make postgres module optional
32890ed46eafb knot-dns: add .meta.changelog
b6aa3932ce237 nixos/lib/qemu-common: fix cross to x86_64 (#327349)
122f86cec61e7 tagger: fix build with strictDeps
194de8cdd3d91 github-runner: fix build with strictDeps
7e3d4971b9031 dafny: fix build with strictDeps
3c19fbca2429a k0sctl: 0.19.2 -> 0.19.4
e2dabfa5e1ca0 osmscout-server: 3.0.0 -> 3.1.0 (#339758)
4e2aca6051827 pulumi-esc: 0.11.0 -> 0.11.1
8adcc7fc3a42b crystal: add fish completions (#362279)
3c349d1ffb31e nixos/vault-agent: make template value optional (#283534)
0c08b2b82a468 Cinnamon updates 2024-12-05 (#362092)
9ff1494545fa2 sbctl: 0.14 -> 0.16 (#332560)
2b6dd1e5a4f3b woof-doom: 15.0.0 -> 15.0.1
541eefafee65a xmrig-mo: 6.22.1-mo1 -> 6.22.2-mo1
1b23de0eae699 hypnotix: 4.6 -> 4.7 (#362277)
fe99acdd31e2b woof-doom: add nix-update-script
2361852cc5bf2 maintainers/scripts: add check-maintainer-usernames
a2420d6b98174 maintainers: update GitHub names
732a49ecc902c protonmail-desktop: 1.0.6 -> 1.5.1 / fix update-script (#356737)
44082b371a42f python312Packages.globus-sdk: 3.48.0 -> 3.49.0
b11ff5d1d5dba python312Packages.boto3-stubs: 1.35.72 -> 1.35.74, python312Packages.botocore-stubs: 1.35.72 -> 1.35.73 (#361581)
c14b69704a9eb knot-dns: 3.4.2 -> 3.4.3
2f66cc6748b51 abcmidi: 2024.10.10 -> 2024.12.06
16be790812b5c fwupd: 2.0.2 -> 2.0.3
ccbc75e3e9e8e delly: 1.3.1 -> 1.3.2
0850b8d575c01 vimPlugins.lazy-nvim, vimPlugins.LazyVim: update on 2024-12-06 (#362369)
c4cfde7078eea python312Packages.samsungtvws: 2.7.0 -> 2.7.2
7ad1c658a7057 crystal: prefer installShellCompletion and installManPage
3a5dd14065682 python312Packages.google-cloud-dlp: 3.23.0 -> 3.25.1 (#362318)
d23cf6671fea1 oras: 1.2.0 -> 1.2.1
31e2b89076310 python312Packages.roadlib: 0.27.0 -> 0.29.0 (#362001)
6bf2358f4a11c simdjson: 3.10.1 -> 3.11.0
7e9b948b5a040 metasploit: 6.4.37 -> 6.4.39 (#362165)
32cfa7e13b472 checkov: 3.2.328 -> 3.2.330 (#362167)
745ee122cb356 nuclei-templates: 10.0.4 -> 10.1.0 (#362168)
718426a0277fa prowler: 4.6.1 -> 5.0.0 (#362169)
31533747ba9b6 python312Packages.mypy-boto3-kendra: 1.35.0 -> 1.35.75, python312Packages.mypy-boto3-sagemaker: 1.35.68 -> 1.35.75 (#362175)
bcb1005a5bbbf python312Packages.plugwise: 1.6.1 -> 1.6.2 (#362176)
1d866e6339db4 python312Packages.aiohomeconnect: 0.6.2 -> 0.6.3 (#362178)
4140c07b02e12 oxker: 0.8.0 -> 0.9.0
6ef358258f8c7 python312Packages.slack-sdk: 3.33.4 -> 3.33.5 (#362179)
3eac3a5c65a72 python312Packages.upb-lib: 0.5.8 -> 0.5.9 (#362242)
c278fa738d8c1 cnspec: 11.33.0 -> 11.33.1
f52a24bc1ba10 python312Packages.twilio: 9.3.7 -> 9.3.8 (#362180)
97dffecc0fe4d sqlline: init at 1.12 (#359236)
07fa42fef27e3 python312Packages.check-manifest: 0.49 -> 0.50 (#362183)
8583c47ec13d1 dnf5: 5.2.8.0 -> 5.2.8.1
df58b71c01482 sqlmap: 1.8.11 -> 1.8.12 (#362185)
5873cbc25d8ac crowdsec: 1.6.3 -> 1.6.4 (#362186)
607bcbbc19def urlscan: 1.0.3 -> 1.0.6 (#362202)
1d6bac5bec1b8 flexget: 3.11.49 -> 3.12.1 (#362212)
0138f40ad1994 httping: 4.1.0 -> 4.2.0 (#362214)
46e6d02933432 python312Packages.msgraph-sdk: 1.13.0 -> 1.14.0 (#362238)
7198eec9b9de8 python311Packages.pytelegrambotapi: 4.23.0 -> 4.24.0 (#362237)
0464a87f3a928 python312Packages.skyboxremote: init at 0.0.6 (#362245)
046886a4b101a python312Packages.pynordpool: init at 0.2.2 (#362246)
da92d1a5e3f55 python312Packages.botocore-stubs: 1.35.74 -> 1.35.76
2a25904a7217c python312Packages.boto3-stubs: 1.35.74 -> 1.35.76
48baa494a0b31 python312Packages.botocore-stubs: 1.35.73 -> 1.35.74
8f4f4b7287177 python312Packages.botocore-stubs: 1.35.72 -> 1.35.73
bb8a04411c86b python312Packages.boto3-stubs: 1.35.72 -> 1.35.74
408068a3eb3e2 clash-rs: set mainProgram to clash (#362385)
3cfec09792b13 lua-language-server: 3.13.2 -> 3.13.3
097248f4e0368 nixos/nscd: increase default timeout to 10 seconds (#290355)
527af4129c7db {open,edge}tx: add meta.mainProgram (#361901)
2160e7db923d9 zulip: build package from source (#279545)
e8151e1869500 gitlab-release-cli: 0.19.0 -> 0.20.0
7b9861a58763b polybar: remove references to cc before makeWrapper (#353419)
889f246473030 clash-rs: set mainProgram to clash
55da4621f54e2 docker-init: v1.3.0 -> v1.4.0
28e73148eabc0 xournalpp: 1.2.4 -> 1.2.5
e5742015525cc ocamlPackages.reason-react: init at 0.15.0 (#361483)
9d186449dc922 radicle-httpd: 0.17.1 -> 0.18.0 (#362281)
a29d846e26d26 filesender: 2.50 -> 2.51
13ba4d646c886 kdiff3: 1.11.4 -> 1.11.5
f59f2daba3d5b ocamlPackages.mirage-crypto-rng-eio: init at 1.1.0
c80280682b5dd rutorrent: 4.3.8 -> 5.1.1
ca2fd2e8d2ac3 nixos/release-notes: Fix broken option links (#362370)
c769b4d2fb9ce weaver: 0.10.0 -> 0.11.0
5011a2c53c009 parallel: 20240922 -> 20241122 (#362098)
bd200697e9d95 nixos-rebuild-ng: show help when manpage is disabled
8f1894ffd3018 xournal: drop
f57ae5aba93b0 intel-compute-runtime: 24.39.31294.12 -> 24.45.31740.9
4f8eb8d6b372a ocamlPackages.reason-react: init at 0.15.0
bce3c80f903de nixos/release-notes: Fix broken option links
f883190cf10a9 ledger-live-desktop: 2.89.1 -> 2.92.1 (#362315)
0c657ff633897 vimPlugins.lazy-nvim, vimPlugins.LazyVim: update on 2024-12-06
8a693f4e59afb xfsprogs: 6.11.0 -> 6.12.0
9d9d11a67345a python312Packages.publicsuffixlist: 1.0.2.20241203 -> 1.0.2.20241205 (#362355)
e6e07531bcb40 nixos/languagetool: fix description on allowOrigin option (#315412)
c933df874ca07 grip-grab: init at 0.6.7
91f2c5f2a2f73 nixos/postfix: add missing mkDefault for smtpd tls config (#343805)
781e061652041 cargo-sort: 1.0.9 -> 1.1.0
63a6762cdfe75 nixos/gotenberg: fix service config for chromium (#346639)
c11e96af6cbfb audiobookshelf: 2.17.2 -> 2.17.4
00c682e770861 joypixels: 8.0.0 -> 9.0.0 (#349056)
8089e6b43a9ff opentofu: 1.8.6 -> 1.8.7 (#362110)
0a1505336a292 gh: 2.63.0 -> 2.63.2
9486e836ccf7a zenoh: initial add 1.0.3
896813431f304 maintainers: add cryo
b3ae859368264 python312Packages.publicsuffixlist: 1.0.2.20241203 -> 1.0.2.20241205
46cf534832cd6 treewide: drop more gtk2 packages (#361708)
7dd001f3e2024 argon: init at 2.0.21 (#351091)
d8dfbe84b9046 deepin.deepin-turbo: remove (#362343)
2936a2ab9ba61 lib.strings.concatMapAttrsStringSep: init (#330010)
7da5162201ba9 eccodes: 2.36.0 -> 2.39.0
2c5f0b0e5f1f0 deepin.deepin-turbo: remove
abe6f1d91b142 sqlline: init at 1.12
de5658c9e4d0d deepin.deepin-calculator: 5.8.24 -> 6.5.2 (#362023)
a2cd533bdc01c nixos/doc/rl-2505: release notes for fluxus, racket_7_9
20993a11e3b30 racket_7_9: drop
67d1a8ce89848 epic5: 3.0.1 -> 3.0.2
c77dab3ae5c71 linux_6_12: 6.12.2 -> 6.12.3 (#362325)
d35f40d3b310c fluxus: drop
9efa9ce516b3c Plasticity: Fix EGL
10f4a9ab7541c linux/common-config: enable support for crashkernel dumps (#347932)
f2edd270bfff7 linux config: enable cp15 barrier emulation on aarch64 (#354867)
5a787efe66e82 linux_6_12: 6.12.2 -> 6.12.3
a32211bb76f82 python312Packages.transformers: 4.46.3 -> 4.47.0
ac3c4a9fa08f5 python312Packages.tokenizers: 0.20.3 -> 0.21.0
33edad5d40ffa vsce/python: fix `pythonUseFixed`
f81aa03570b32 python312Packages.azure-mgmt-relay: fix msrest dependency (#362152)
2789978d14e2b phpExtensions.tideways: 5.14.0 -> 5.16.2 (#362267)
f3f54e50c0408 nodePackages.webpack-dev-server: drop (#362209)
d5716a34c9c58 phpPackages.phpstan: 2.0.2 -> 2.0.3 (#362259)
cf888a939ef2f python312Packages.azure-mgmt-logic: remove msrestazure dependency (#362156)
521bd4db8e5c9 python312Packages.google-cloud-dlp: 3.23.0 -> 3.25.1
22eb3277d79ef act: 0.2.68 -> 0.2.70 (#356372)
2b413270b507d ocamlPackages.js_of_ocaml: 5.8.2 → 5.9.1
af13d121e5671 wsysmon: remove procps dep and dynamically link spdlog (#343608)
cfc007382b8ba basex: 11.4 -> 11.6
e47ca1c49b39f clash-rs: 0.7.1 -> 0.7.3 (#359917)
0d4fa9db415fb llm: 0.17.1 -> 0.19 (#357075)
8c39875ae3f7a nixos/github-runner: use bashInteractive instead of bash (#339875)
77136f2adecba ledger-live-desktop: 2.89.1 -> 2.92.1
3848cb1761b14 bash-completion: hack around a release bug impacting BSDs (#360045)
64101f5ffbcf8 kopia: add shell completion scripts (#360216)
0e79533e24566 python3Packages.django-mfa3: Disable failing test (#362045)
185f392904f3f kind: 0.2.4 -> 0.2.5 (#355534)
4f9c3c087a9a3 dprint: add shell completions (#362139)
4820a4115cac9 copacetic: init at 0.9.0 (#357407)
5e3bd16ee8582 stylua: 0.20.0 -> 2.0.1
5ae933ec0d684 pv: 1.8.14 -> 1.9.7 (#362069)
e08e46e07aa39 go_1_22: 1.22.9 -> 1.22.10 (#361605)
3ef08b366463a butt: 1.42.0 -> 1.44.0 (#362013)
ebc1f2357757c cpupower: add which to nativeBuildInputs (#362044)
7791730675d41 flake-checker: 0.2.0 -> 0.2.1 (#362074)
c8f8a39a901ea git-open: 3.0.0 -> 3.1.0 (#362111)
0cd0e98df1989 kikoplay: init at 0-unstable-2018-03-22
9ce07d21c7204 mendeley: 2.122.1 -> 2.127.1
102ad463591c1 perlPackages.DBDMariaDB: fix strictDeps = true (#359874)
86014b26f55c8 mighty-mike: init at 3.0.2-unstable-2024-04-01
e4666afa18982 eza: 0.20.10 -> 0.20.11 (#362043)
8961ce813978b python312Packages.hg-git: 1.1.3 -> 1.1.4 (#362031)
47eb6c1225908 warp-terminal: 0.2024.11.19.08.02.stable_03 -> 0.2024.12.03.08.02.stable_04
d90d79a605f25 lima: prefer hash rather than sha256 in fetchFromGitHub
b994f1fa5aa1d lima: make sure it does not use pname for reponame
3edf8697d5f67 mailspring: 1.13.3 -> 1.14.0 (#361876)
1793ec791a0f1 mangayomi: init at 0.3.75 (#360181)
69b6ca0af8adb minimal-grub-theme: init at 0.3.0 (#361311)
226b3704236a0 tests.overriding: simplify implementation with lib.concatMapStringAttrsSep
037a7cbe01b02 apptainer: singularity: use lib.concatMapAttrsStringSep
b1371135b5db3 lib.strings.concatMapAttrsStringSep: init
c2dc40eb4d52b resources: 1.6.0 -> 1.7.0 (#362143)
a3551324c60d8 inputstream-adaptive: add symlink to libcdm_aarch64_loader, remove symlink for libssd_wv (#339580)
6e1b044e9e61d nixos/redmine: Add PrivateMounts to systemd unit settings (#361065)
0b5368a9421b2 twig-language-server: 0.5.1 -> 0.6.0
3e0af441a9d8c hypr-dynamic-cursors: 0-unstable-2024-11-10 -> 0-unstable-2024-11-19 (#362075)
6ca2e8aebab15 treewide: remove unused {lib,}clang from more build closures (#361298)
5f49a16745277 qtcreator: 14.0.2 -> 15.0.0 (#361650)
701b2a94cf621 python312Packages.cvelib: 1.6.0 -> 1.7.0
bf3e82c1f8b6d gnome-online-accounts-gtk: 3.50.4 -> 3.50.5 (#362274)
7e78a81755083 argon: init at 2.0.21
80bcf2625b3ed tailscale: 1.78.0 -> 1.78.1 (#362280)
3ed7532a54770 maintainers: add github attribute to amozeo (#360436)
f3b8df42ef124 containerlab: 0.59.0 -> 0.60.0
2a6b716fb4ec7 ArchiSteamFarm: 6.0.8.7 -> 6.1.0.3
4c58b47964ec5 new-lg4ff: 0.4.0 -> 0-unstable-2024-11-25 (#360385)
608e99e3d3306 tailscale: 1.78.0 -> 1.78.1
50d2d70cbabdc maintainers: add StayBlue
f652022407928 python312Packages.molecule: 24.9.0 -> 24.12.0
e7be80fdcdb00 radicle-httpd: 0.17.1 -> 0.18.0
6012143d23a75 argocd: 2.12.6 -> 2.13.1; add fish completions (#358264)
10004864a1ffa hypnotix: 4.6 -> 4.7
954e48a4e0f08 free42: 3.1.8 -> 3.1.10 (#361219)
81e6459faa779 dprint: add shell completions
555b648374a6b witness: 0.6.0 -> 0.7.0
596eb73570b14 gnome-online-accounts-gtk: 3.50.4 -> 3.50.5
5eafabf8dba1f beedii: init at 1.0.0 (#349097)
f212b495d309f dprint: 0.47.2 -> 0.47.6 and add version test (#354977)
a9137d056b6e4 kind: enable doCheck and add passthru.tests (#361466)
273369477b58d phpExtensions.blackfire: 1.92.28 -> 1.92.29
e3382c257c3fd crystal: add fish completions
110f55850c24c turbo: 2.3.0 -> 2.3.3 (#361921)
d3bd0040f232d nixos-rebuild: add thiagokokada as maintainer (#362244)
e68588e701ed5 hugo: enable doCheck with skipping failing tests (#361975)
02e0bf0e6ec91 python312Packages.binance-connector: 3.9.0 -> 3.10.0 (#360162)
1566a6b69c478 phpExtensions.tideways: 5.14.0 -> 5.16.2
54862bcdfbe78 linuxKernel.kernels.linux_zen: 6.12.1-zen1 -> 6.12.2-zen1
08239ae70716a copacetic: init at 0.9.0
ce5d74fbbafd7 python310: 3.10.15 -> 3.10.16
239c4467200aa python39: 3.9.20 -> 3.9.21
cebe48a77cf54 ndcurves: 1.4.1 -> 2.0.0
173c0f3194470 tplay: remove unused libclang from build closure
ab01eb0370954 solana-validator: remove unused libclang from build closure
ae045ab274b0a stratovirt: remove unused libclang from build closure
c3e0876a96cc4 mchprs: remove unused clang from build closure
661900b39980b zed-editor: remove unused clang from build closure
0e3c98fe7b385 linuxKernel.kernels.linux_lqx: 6.12.1-lqx1 -> 6.12.2-lqx3
fb93e0b7c9b31 phpPackages.phpstan: 2.0.2 -> 2.0.3
5c9f8971713e8 subread: 2.0.7 -> 2.0.8 (#361977)
867db1d91e417 Linux kernels 2024-12-05 (#362160)
bf94a919945f0 shufflecake: 0.4.4 -> 0.5.1
01c804f466426 bore-cli: 0.5.1 -> 0.5.2
5e9ea2c73c142 logrotate: disable acl on non-Linux platforms (#283483)
4f2613d90c91f jprofiler: 13.0.6 -> 14.0.5 (#360246)
47a92239db469 cargo-shuttle: 0.47.0 -> 0.49.0 (#361827)
ad4171cd3929b staruml: 6.2.2 -> 6.3.0 (#361340)
d4297d0e0c852 julia_111{,-bin}: 1.11.1 -> 1.11.2, julia_19{,-bin}: drop (#361178)
7e495fadb205b gotemplate: 3.11.0 -> 3.12.0
72d4d09d23d24 treesheets: fix darwin build
3ac4e337e1e49 treesheets: 0-unstable-2024-09-08 -> 0-unstable-2024-11-24
debfc9f3bb91c typora: add launcher
08e8952e1ab13 python312Packages.pynordpool: init at 0.2.2
21de726c192ca mailpit: 1.21.0 -> 1.21.5 (#360646)
3416e72d6523d gitoxide: 0.38.0 -> 0.39.0 (#360861)
8e770757c6d06 jazz2: 2.9.1 -> 3.0.0 (#360909)
44010ed604ab4 python312Packages.skyboxremote: init at 0.0.6
092aef6491b10 pdfium-binaries: 6721 -> 6872 (#359931)
1551874a6ae20 lynx: 2.9.0dev.12 -> 2.9.2 (#362192)
9b260257ff2bd home-assistant: update component-packages
61194a6d4b7dc maelstrom-clj: 0.2.3 -> 0.2.4 (#361932)
2d50bdc0afdf4 python312Packages.pylamarzocco: 1.2.3 -> 1.2.11
eec5a8bdb875d nixos-rebuild: add thiagokokada as maintainer
77fb5441bfe18 graphene-hardened-malloc: add updateScript (#360468)
b6a73a110fcc6 python312Packages.upb-lib: 0.5.8 -> 0.5.9
97f1216c3f660 wipeout-rewrite: 0-unstable-2024-07-07 -> 0-unstable-2024-11-09
5eb75bf013ce3 sidplayfp: Modernise
b5db689b8ac95 sidplayfp: 2.11.0 -> 2.12.0
abb5090d1ef1f mangayomi: init at 0.3.75
4a9420c739e82 libsidplayfp: 2.11.0 -> 2.12.0
8cd32243b55b8 python311Packages.pytelegrambotapi: 4.23.0 -> 4.24.0
979c64655bbfa joplin-desktop: fix unpacking on x86_64-darwin with 7zz (#361912)
2843169b006a1 cargo-modules: 0.19.1 -> 0.20.2
bc85e2eac5598 python312Packages.msgraph-sdk: 1.13.0 -> 1.14.0
7016c90a7e575 tailscale: 1.76.6 -> 1.78.0 (#362225)
e4b06f587ee43 sptlrx: 1.1.0 -> 1.2.2 (#360405)
07f102059297e python312Packages.gradio-pdf: 0.0.17 -> 0.0.19 (#361804)
e1bf3822864e7 haguichi: Migrate to by-pkgs
0e8a27ece5bcc haguichi: nixfmt
c311c34523a38 haguichi: 1.5.0 -> 1.5.1
9234025c07ae9 OWNERS: update python update script ownership
80cdb176ad6fa tailscale: 1.76.6 -> 1.78.0
7c0fc9cf188a3 famistudio: .NET 7 -> 8 (#361867)
8f2b01cb67cb3 update-python-libraries: migrate git revs to use tag
b8704b00bcbb0 update-python-libraries: fix helper script after by-name migration
b14e7f5fc29be miriway: 24.10.1 -> 24.11.1
db2b768ef87dc miracle-wm: Fix compat with mir 2.19
d8840638d26b6 mir: 2.18.3 -> 2.19.2
839585c58c032 youtube-music: fix desktopName and startupWMClass
a58774a9689eb gqmqtt: init at 0.2.0-alpha (#360312)
6cf39d3d7accf flexget: 3.11.49 -> 3.12.1
af327b3493667 taterclient-ddnet: 9.0.0 -> 9.0.1 (#360538)
5a8f83664cab1 httping: 4.1.0 -> 4.2.0
4b641f48a4c21 nodePackages.webpack-dev-server: drop
56262ecfd3f87 milkytracker: Migrate to by-name
089f7815b4b1c milkytracker: Modernise
a60896307182e python312Packages.pyreadstat: 1.2.7 -> 1.2.8 (#360532)
e0e69f2d76227 milkytracker: 1.04.00 -> 1.05.01
e80f0513591c7 linuxPackages.r8125: 9.013.02 -> 9.014.01 (#361615)
9a10296d87755 urlscan: refactor
20ad8360fa783 codeberg-cli: 0.4.3 -> 0.4.6
dd34a907fac04 urlscan: 1.0.3 -> 1.0.6
2e0d114024866 flirt: init at 0.2 (#362189)
8323395a04dc2 oh-my-posh: 23.20.3 -> 24.11.4 (#362171)
14e7e223a1b91 komac: add shell completions (#362157)
ce5e6aac3f870 stella: 7.0 -> 7.0b (#361408)
7cb3aa38e527a opentelemetry-collector-contrib: fix darwin builds (#362159)
485abf95896f8 resources: 1.6.0 -> 1.7.0
73e492d365dc0 dotnetCorePackages.dotnet_9.vmr: 9.0.0 -> 9.0.101
9bb136edda316 dotnet: nixfmt output of nuget-to-nix (#361579)
96af88adc81c7 lynx: 2.9.0dev.12 -> 2.9.2
48733b509ecef nixos/prometheus-restic-exporter: add option to specify repository as a file (#344983)
54dcafdd31156 drm_info: 2.3.0 -> 2.7.0
9dcb0c5ddae42 drm_info: move to by-name, adopt, format
9b37d566f2019 nixos/asusd: correct suffix of asus/profile.conf to ron (#285904)
92951015e6e0c openseeface: init at 1.20.4-unstable-2024-09-21 (#289617)
76541074a2dbe komika-fonts: init at 0-unstable-2024-08-12 (#334261)
9751944f85ec8 flirt: init at 0.2
8b5bc060a92e9 maintainers: Add adda
62ef0ec30365d rtorrent: use vendored tinyxml2 for XMLRPC
716603a233d17 python312Packages.pyqt-builder: 1.16.4 -> 1.17.0
188e988f72f4f sqlmap: 1.8.11 -> 1.8.12
76c13cf2c2da2 crowdsec: 1.6.3 -> 1.6.4
b0749e8e6fbce linuxPackages.nvidiaPackages.latest: 560.35.03 -> 565.77 (#362162)
20f7926344faf python312Packages.sip: 6.8.6 -> 6.9.0
6dc317f692e84 python312Packages.azure-multiapi-storage: fix build (#362147)
440ec8bb8146b python312Packages.check-manifest: 0.49 -> 0.50
ddd75c825beae python312Packages.aiohomeconnect: 0.6.2 -> 0.6.3
5470d9663b6aa python312Packages.slack-sdk: 3.33.4 -> 3.33.5
92b48d7717934 python312Packages.twilio: 9.3.7 -> 9.3.8
dd9608a5d82e7 dotnet/update.nix: use tag name to check for updates
a611045f3df0b arrpc: 3.4.0 -> 3.5.0; add systemd user service
376975bdf6645 arrpc: format
a390ec54d9c89 qemu: fix strictDeps (#358487)
4cb91d62e0652 python312Packages.plugwise: 1.6.1 -> 1.6.2
a0b7a4ea1e295 eksctl: 0.194.0 -> 0.197.0
f63243de45c1e python312Packages.azure-mgmt-relay: slightly modernize
124b22467423c python312Packages.azure-mgmt-relay: remove unused dependencies
21e9e52183fd5 linuxPackages.nvidiaPackages.vulkan_beta: 550.40.80 -> 550.40.81 (#362164)
a8fd645b08199 komac: add shell completions
d0316395c33e3 oh-my-posh: 23.20.3 -> 24.11.4
497d9e140d807 python312Packages.mypy-boto3-sagemaker: 1.35.68 -> 1.35.75
4346b82dc7a62 python312Packages.mypy-boto3-kendra: 1.35.0 -> 1.35.75
2585e41503d41 prowler: 4.6.1 -> 5.0.0
915a9de5b3ab3 linuxPackages.nvidiaPackages.latest: 560.35.03 -> 565.77
e19e156796ad0 fsautocomplete: 0.73.2 -> 0.75.0 (#360986)
0bca244b37ea1 qpwgraph: 0.7.9 -> 0.8.0 (#362057)
50635d4aa3c99 metasploit: 6.4.37 -> 6.4.39
1371a1605d989 burpsuite: 2024.10.1 -> 2024.11.1 (#360758)
fbc5b67ceb97d nanopb: 0.4.9 -> 0.4.9.1 (#362032)
76f17a419ac0c linuxPackages.nvidiaPackages.vulkan_beta: 550.40.80 -> 550.40.81
d238584a09dc7 dotnet/update.nix: remove stray debug print
4f8728c893b69 linux_6_11: 6.11.10 -> 6.11.11
2cc3ff02022b8 linux_6_12: 6.12.1 -> 6.12.2
17ddfd8ca1090 opentelemetry-collector-contrib: fix darwin build
11cbbfdd08440 python312Packages.azure-mgmt-logic: modernize
4b11103f9da89 python312Packages.azure-mgmt-logic: remove msrestazure dependency
d148c22b95472 qhexedit2: init at 0.8.9 (#343340)
b1d10ad85e168 dotnet-sdk_9: 9.0.100 -> 9.0.101
62fb70556cc6d python312Packages.azure-multiapi-storage: modernize and fix metadata
4ba028e8856a3 dotnet/update.sh: check sdk version when updating
cb8dd4a8adc9f opengist: 1.7.5 -> 1.8.3
5873ae414338d ibm-plex: add sans-sc family (#361469)
07e0e431b1d35 qhexedit2: init at 0.8.9
3f056db59cc2b ibus: fix cross compilation (#346076)
6faab9df81591 python312Packages.azure-mgmt-hdinsight: modernize
d6a797d5c95d2 python312Packages.azure-mgmt-hdinsight: remove msrestazure dependency
9c51cc752f1e0 palemoon-bin: 33.4.1 -> 33.5.0
692575b159dd0 adw-gtk3: 5.5 -> 5.6 (#360512)
5fb97b7ad5c3f docker-init: init at v1.30.0 (#356191)
04bf3d877437f nixos/modules/virtualisation: additional configuration options (#349537)
548c320a5ed2c python312Packages.azure-mgmt-servicebus: modernize
51e98f6c7965f vscode-extensions.ltex-plus.vscode-ltex-plus: init at 15.3.0 (#362085)
9e7fccbc7cf89 python312Packages.azure-mgmt-servicebus: remove unused msrestazure dependency
3477b395af108 hyprgui: 0.1.9 -> 0.2.0
6370e0f9a45b8 python312Packages.azure-multiapi-storage: fix build
a2328f5839588 kopia: enable doCheck (#362018)
e2ff9880971d9 dclock: init at 0.1.0 (#361576)
5f5310b145379 apptainer: 1.3.5 -> 1.3.6 (#361914)
8ba7a982700b6 element-call: 0.6.3 -> 0.7.1 (#361044)
98ebcdc8e6cd2 oneanime: init at 1.3.6 (#361485)
e0a5787289a26 kopia: 0.17.0 -> 0.18.2 (#357832)
0254bc67821a9 apptainer, singularity: fix the update instructions in the comment
bd3ea645591cd cpupower: add `which` to nativeBuildInputs
d4fc8be8a57c5 oneanime: init at 1.3.6
91a69c874cf29 proton-pass: 1.24.1 -> 1.25.0
958bee59f416d python312Packages.rivet: 4.0.1 -> 4.0.2
b6c7c3abceb62 release-plz: 0.3.98 -> 0.3.110
2b6e06055073b cargo-deb: 2.7.0 -> 2.9.1
70f3a1673a438 handbrake: 1.8.2 -> 1.9.0
9e8fac2a586b3 parallel: fix strictDeps
8fb55a6eb93c8 Revert "scarab: remove nuget patch"
194c000ab52a4 wiki-tui: 0.8.2 -> 0.9.1
7822cb34f86bc fetchgit{,hub}: add tag argument (#355973)
3fbdc36f5b89f termshot: 0.2.8 -> 0.2.12 (#361852)
e9a31f51468e4 fetchgit{,hub}: assert illegal tag + rev combinations
f9627eafd4298 git-open: 3.0.0 -> 3.1.0
4ae5e6518e133 opentofu: 1.8.6 -> 1.8.7
949cdbb64c140 python312Packages.recurring-ical-events: 3.3.3 -> 3.3.4 (#361883)
9c34193fcba32 python312Packages.zope-exceptions: 5.1 -> 5.2 (#361639)
1306de2eec13c wgpu-native: init at 22.1.0.5 (#362014)
f5ed5aa6730e2 python312Packages.transaction: 4.0 -> 5.0 (#361685)
61220b974e1e4 element-desktop: 1.11.86 -> 1.11.87 (#361707)
1bfaefdc7b50f emacsPackages.ebuild-mode: drop maintainership (#362104)
f489a60576007 hyprlandPlugins.hyprscroller: 0-unstable-2024-11-23 -> 0-unstable-2024-11-29 (#360964)
0f013251650b9 python312Packages.plaid-python: 27.0.0 -> 28.0.0 (#362056)
9036f4a0c9ed8 emacsPackages.ebuild-mode: drop maintainership
e039cdd968efb lunacy: 10.0.1 -> 10.9.0 (#362008)
8560773da2951 commonsCompress: 1.26.2 -> 1.27.1 (#362011)
e2a3323d0047a raycast: 1.87.2 -> 1.87.4
aa78cc3dba192 google-alloydb-auth-proxy: init at 1.11.3 (#357420)
19b44a75baa97 timeular: 6.8.4 -> 6.8.5 (#362029)
d6c2d483f153e python312Packages.yattag: 1.16.0 -> 1.16.1 (#361969)
3b124c3c6233b sakura: 3.8.7 -> 3.8.8 (#361970)
10f375a0e97cb openstackclient-full: 7.2.0 -> 7.2.1 (#361976)
1b534cb813c05 python312Packages.mockito: 1.5.1 -> 1.5.3 (#361983)
afbcac7241774 remotebox: 2.7 -> 3.4
4bd660accd407 nimdow: 0.7.39 -> 0.7.40 (#361989)
c2ec45335319a gnome-network-displays: 0.93.0 -> 0.94.0 (#361995)
cd89605adf93c commonsIo: 2.17.0 -> 2.18.0 (#361996)
8504394b66513 door-knocker: 0.5.0 -> 0.6.0 (#361997)
63262e6ed943b wxmaxima: 24.08.0 -> 24.11.0 (#361998)
fd55f36c22220 tagparser: 12.3.1 -> 12.4.0 (#361927)
61c7b94dfb6c8 sticky: 1.22 -> 1.23
557621a10f51d lightdm-slick-greeter: 2.0.7 -> 2.0.8
389601fa73569 xviewer: 3.4.6 -> 3.4.7
c49b11790bef7 warpinator: 1.8.6 -> 1.8.7
88efcceaa6da8 pix: 3.4.3 -> 3.4.4
5bc48afb8338e nemo: 6.4.2 -> 6.4.3
d01b81f384d52 folder-color-switcher: 1.6.5 -> 1.6.6
e9a855fb8fc02 cinnamon-translations: 6.4.0 -> 6.4.1
f0308754b598c cinnamon-control-center: 6.4.0 -> 6.4.1
5cab70eb47be8 cinnamon-common: 6.4.1 -> 6.4.2
1433a8fcd99aa bulky: 3.4 -> 3.5
64d823c7cbf89 smug: 0.3.5 -> 0.3.6 (#361958)
7770039f3dfc2 alt-tab-macos: 7.4.0 -> 7.7.0 (#361890)
92afb633ad3e0 stats: 2.11.18 -> 2.11.19 (#361891)
8c6c337edc79c soundsource: 5.7.3 -> 5.7.4, quote paths, refactor meta (#361892)
e94fb7d3a209b raycast: 1.86.0 -> 1.87.2 (#361893)
51c4a6cd8b7c1 fedifetcher: 7.1.12 -> 7.1.14
23468182b1d50 juicefs: 1.2.1 -> 1.2.2 (#361916)
14629763274ae reviewdog: 0.20.2 -> 0.20.3 (#361919)
e869c6173a67a prometheus-nginx-exporter: 1.3.0 -> 1.4.0 (#361866)
9970958d8d94f parallel: 20240922 -> 20241122
114e26b74a705 supabase-cli: 1.210.1 -> 2.0.0 (#361826)
42495eef2efbe python312Packages.django-leaflet: 0.30.1 -> 0.31.0 (#361828)
2d9f607254cbb lombok: 1.18.34 -> 1.18.36 (#361829)
7c954fa614466 xreader: 4.2.2 -> 4.2.3 (#362064)
d343c85889cd9 dotnet: use fallback target packages from current binary sdk
597474a8f184e dotnet: nixfmt output of nuget-to-nix
4c9ddcbc1a2bc caprine: 2.60.1 -> 2.60.3; disable autoUpdate (#361842)
65e0eebf2dd75 nixos/victoriametrics: the prometheusConfig option isn't null by default (#361778)
ca2960ed2f72e mate.mate-notification-daemon: 1.28.1 -> 1.28.3 (#361798)
16d2b6e90863f dependency-track: 4.12.1 -> 4.12.2 (#361783)
8fad995ebcf59 xapp: 2.8.6 -> 2.8.7 (#362068)
70902f96549de xed-editor: 3.6.7 -> 3.6.9 (#361791)
8b01c3e57149f scarab: .NET 6 -> 8 (#361251)
5009f6e7ae134 intel-gmmlib: 22.5.2 -> 22.5.4 (#362046)
9cb2a61d1a397 python312Packages.rpy2: 3.5.16 -> 3.5.17 (#361796)
d641ace37090b rpPPPoE: 3.12 -> 4.0 (#349480)
492818a9e38ea scarab: avoid rebuild after `meta` changes
73f99fe4ca11a scarab: explicit `rev` and `pname` in `fetchFromGitHub`, migrate to hash
7cd9f932236ea scarab: remove nuget patch
a46125dd5d9fa scarab: .NET 6 -> 8
d87b843af3b43 scarab: migrate to by-name
11bca208933fc vscode-extensions.ltex-plus.vscode-ltex-plus: init at 15.3.0
93382b5e83e76 google-alloy-db-auth-proxy: init at 1.11.3
6cb56c519a4c4 doc/dotnet: bump .NET versions from 6, 7 to 8, 9 (#361243)
8e8b8c9e6dc09 python312Packages.nlpcloud: 1.1.46 -> 1.1.47 (#361158)
5eaa12216f51e nuclei-templates: 10.0.4 -> 10.1.0
27e573eec13b1 checkov: 3.2.328 -> 3.2.330
85c591ae348aa vimPlugins.aw-watcher-vim: init at 2023-10-09
581db02151b5c roslyn-ls: 4.12.0-3.24470.4 -> 4.13.0-3.24577.4 (#357963)
7c38a1c89d44b maintainers: update tsandrini contact info
9894aea69bfd7 ytdl-sub: relax yt-dlp dependency (#361694)
019688919bb29 auto-editor: init at 25.3.0 (#317557)
d294c5a4d2a6e python3Packages.torchtnt: init at 0.2.4  (#361470)
c76137bb4d3e7 wikiman: init at 2.13.2 (#359410)
b2853e04b379f ksmbd-tools: 3.5.2 -> 3.5.3
a3da8b04d20b8 hypr-dynamic-cursors: 0-unstable-2024-11-10 -> 0-unstable-2024-11-19
da566994eac60 nixos-rebuild-ng: enable shell files by default
a987599ac1346 nixos-rebuild-ng: simplify build options
68a1082234b11 nixos-rebuild-ng: add proper manpage using scd format
12f623110b58e nickel: 1.8.1 -> 1.9.0 (#358879)
0509c6be442bc davinci-resolve: 19.0.2 -> 19.1 (#359934)
f2866842c2016 Added dotnet-ef - the core tool of .NET Entity Framework (#361198)
6da0724cf33c0 ci: add Nixpkgs lib-tests workflow
1ddf4cbe9fead haruna: 1.1.2 -> 1.2.1 (#361431)
dcbb8882538a6 mariadb-galera: 26.4.20 -> 26.4.21 (#361467)
916d65a2d022c nixos-rebuild-ng: add shell completion via shtab
b521c0c6bd11e nixos-rebuild-ng: add --builders as common_build_flags
66bcb83578c05 television: 0.5.1 -> 0.5.3 (#361674)
83dad7d43cf20 flake-checker: 0.2.0 -> 0.2.1
07d388a43bf48 Update pkgs/development/python-modules/torchtnt/default.nix
cd9300a45574c nixos/akkoma: Make imports explicit (#320513)
4cce7a0518b81 dosbox-x: 2024.10.01 -> 2024.12.04
178ca33e43529 python3Packages.roma: init at v1.5.1 (#361444)
70d86c64a0572 pdfstudio: fix hash mismatch (#360194)
2f12b59f31b5b nixos/tests/networking: fix flaky scripted.dhcpSimple test (#361834)
20e276f1a267e gnomeExtensions.pano: 22 -> v23-alpha3 (#352899)
58254b5abc556 unrar: 7.1.1 -> 7.1.2
1266ded08f8d4 xapp: 2.8.6 -> 2.8.7
0216b3263c88d ptyxis: 47.4 -> 47.5 (#362055)
f7c9f1aa799aa minimal-grub-theme: init at 0.3.0
3e53e7e7bc04b xreader: 4.2.2 -> 4.2.3
048fa4f7860c7 python312Packages.oslo-log: 6.1.2 -> 6.2.0; fixes; improvements (#362024)
33139a9c81a1a turnon: init at 1.6.1
ae435d0bac519 wgpu-native: init at 22.1.0.5
f70bc8c98219d pv: 1.8.14 -> 1.9.7
35b1e02e9f938 pdfstudio2023: 2023.0.3->2023.0.4
ed6c80272febc pdfstudio: fix hash mismatch
3611f5d63a19e nixos/pykms: Fix eval (#362002)
fc117208b4a1d di: 4.54 -> 4.54.0.1
e54605b8394f1 redocly: 1.25.9 -> 1.25.11
d456aa4fc9ae2 qpwgraph: 0.7.9 -> 0.8.0
fe2a6466c6e96 python312Packages.plaid-python: 27.0.0 -> 28.0.0
1989c9f4b53f8 ptyxis: 47.4 -> 47.5
7a8bfb795f5dc python3Packages.dirsearch: init at 0.4.3 (#350550)
e05f55035c8f8 maltego: 4.8.0 -> 4.8.1 (#361992)
e2e59a7e5250d corectrl: 1.4.2 -> 1.4.3 (#362005)
351fffd897ff3 mirrord: init at 3.125.0 (#349722)
4b0fe83d064e5 kittycad-kcl-lsp: init at 0.1.61 (#355668)
2ff1cccc278ca cloudflare-warp: add versionCheckHook (#358956)
b211fc881d22c deja-dup: 46.1 -> 47.0
a616046311f02 hiddify-app: 2.5.7-unstable-2024-10-30 -> 2.5.7-unstable-2024-11-18 (#360605)
c34effa646212 remod: init at 1.0.1 (#361651)
8be11ab22e0df m8c: init at 1.7.8 (#361671)
af7c522a45880 wordbook: unstable-2022-11-02 -> 0.4.0 (#361748)
a635264f9609a emacsPackages.ebuild-mode: 1.75 -> 1.76
f3e27bc730c99 monkeysAudio: 10.81 -> 10.83
5e74aff1db541 cni-plugins: 1.6.0 -> 1.6.1
0650670854410 python3Packages.django-mfa3: Disable failing test
df46eade40543 eza: 0.20.10 -> 0.20.11
7625dbbe50f06 typora: fix
05e93b530bb16 intel-gmmlib: 22.5.2 -> 22.5.4
c853ed50dc2c0 workflows/eval: add eval summary to commit statuses (#361973)
47799668defc8 mmseqs2: add passthru.tests
4198bea39e4e6 termshot: 0.2.8 -> 0.2.12
8e9d7ac6d1df1 ttfb: 1.13.0 -> 1.14.0 (#361993)
2f95a943f6150 eintopf: 0.14.2 -> 0.14.3; eintopf.frontend: 0.14.2 -> 0.14.3 (#361453)
40caf32dd9795 butt: 1.42.0 -> 1.44.0
8edc70ed5b74b nanopb: 0.4.9 -> 0.4.9.1
e772730caa0db python312Packages.hg-git: 1.1.3 -> 1.1.4
191f38e09634c cloudflare-warp: add versionCheckHook
18a0bec0c0e64 python3Packages.roma: init at v1.5.1
c84109b099378 mmseqs2: move to pkgs/by-name/mm/mmseqs2
5cf1fc3b7325b timeular: 6.8.4 -> 6.8.5
8161f18b42abc mmseqs2: enable neon on aarch64
a603559dccdd1 mmseqs2: use system zstd
a29846ad2be29 mmseqs2: enable cuda support
1681591eda561 mmseqs2: refactor
8680ed927c1c2 mmseqs2: format with nixfmt
c316132f25105 mmseqs2: 15-6f452 -> 16-747c6
628a0d24b0e8b deepin.deepin-calculator: 5.8.24 -> 6.5.2
45d4837c7a8e2 python312Packages.oslo-log: 6.1.2 -> 6.2.0
3c9fb90e4575b python312Packages.oslo-log: switch to fetchFromGitHub
eeed703362e91 python312Packages.oslo-log: misc cleaning
a6346d9f5e0d4 python312Packages.oslo-log: fix build in darwin sandbox
32fd0fa1930b8 vkd3d: 1.13 -> 1.14
5e08416193d56 kopia: enable doCheck
50b1f1121fb4b commonsCompress: 1.26.2 -> 1.27.1
db447cab67b88 python3Packages.torchtnt: init at v0.2.4
44ddedd2be90e lunacy: 10.0.1 -> 10.9.0
fb08f31009ad8 corectrl: 1.4.2 -> 1.4.3
6cc6d2ebce7bc nixos/pykms: Fix eval
a9b433bf9f04c python312Packages.roadlib: 0.27.0 -> 0.29.0
bb2a1fd9b091d m8c: init at 1.7.8
6e70864059f82 wxmaxima: 24.08.0 -> 24.11.0
52166f9bfec3a door-knocker: 0.5.0 -> 0.6.0
651dc94a6379f commonsIo: 2.17.0 -> 2.18.0
6a5614466d671 gnome-network-displays: 0.93.0 -> 0.94.0
39de3af3b1d3d hiddify-app: 2.5.7-unstable-2024-10-30 -> 2.5.7-unstable-2024-11-18
914077c408c45 ttfb: 1.13.0 -> 1.14.0
c22ea8530985f maltego: 4.8.0 -> 4.8.1
8dee843fa6473 nimdow: 0.7.39 -> 0.7.40
65a5bfe394c45 yoshimi: 2.3.3.1 -> 2.3.3.2
d8885f5518116 python312Packages.mockito: 1.5.1 -> 1.5.3
8f97a00f08718 hfst-ospell: 0.5.3 -> 0.5.4
4d9e16e24ac90 subread: 2.0.7 -> 2.0.8
0e2d8416d0525 openstackclient-full: 7.2.0 -> 7.2.1
e6037ddab8756 hugo: enable doCheck with skipping failing tests
08a7dd9e12a60 sakura: 3.8.7 -> 3.8.8
96ce00dc5ed99 python312Packages.yattag: 1.16.0 -> 1.16.1
6fa847d266977 python312Packages.django-admin-datta: 1.0.11 -> 1.0.15
fcc4ffb488bad postfix: 3.9.0 -> 3.9.1
3da44299e85d4 olvid: 1.6.2 -> 2.2.0
7096d05302ef3 logrotate: disable acl on non-Linux platforms
42f325451d7e0 smug: 0.3.5 -> 0.3.6
435da03a6e6e3 dprint: move to pkgs/by-name
cf5c3ee399803 dprint: 0.47.5 -> 0.47.6
d5326bc21787f llm: 0.17.1 -> 0.19
5aea15ef39b08 act: 0.2.68 -> 0.2.70
25d2577bebfd7 act: add updateScript
77a0bdd5afe11 scrcpy: 3.0 -> 3.0.2
5fbd8b3558e3c hurl: 5.0.1 -> 6.0.0
a923ebbe806af maelstrom-clj: 0.2.3 -> 0.2.4
849e76f9329eb julia_111: 1.11.1 -> 1.11.2
000133b4ab900 julia_111-bin: 1.11.1 -> 1.11.2
17090e527e9b9 anki: 24.06.3 -> 24.11
1cc7ce3589598 tagparser: 12.3.1 -> 12.4.0
310f6e70af89d turbo: 2.3.0 -> 2.3.3
e5bd86b7518c0 maintainers: Add jiriks74
ee1c6b6384591 turbo: importCargoLock -> fetchCargoVendor
880661b8422d9 reviewdog: 0.20.2 -> 0.20.3
c95a2170eee4d apptainer: 1.3.5 -> 1.3.6
77f4d48cb4be8 juicefs: 1.2.1 -> 1.2.2
f4be7b83f1544 _010editor: init at 15.0.1
acee313dfc257 cpp-utilities: 5.26.1 -> 5.27.0
f4e7a058383d3 edgetx: add meta.mainProgram
b2e88ebdded3a opentx: add meta.mainProgram
853e29c954016 raycast: 1.86.0 -> 1.87.2
0d336e398fb36 soundsource: 5.7.3 -> 5.7.4
4c0350d9d096a soundsource: quote paths
4657c1608956f soundsource: refactor meta
bb0c302eaee04 stats: 2.11.18 -> 2.11.19
609cc0dfead62 alt-tab-macos: 7.4.0 -> 7.7.0
14d9dc1b8c384 python312Packages.recurring-ical-events: 3.3.3 -> 3.3.4
a0ee21ff9dc8f mailspring: 1.13.3 -> 1.14.0
56da44bfe9170 dclock: init at 0.1.0
2df2c8b25a834 prometheus-nginx-exporter: 1.3.0 -> 1.4.0
6498028369ccd famistudio: remove `with lib;`
73363329ba9e7 famistudio: .NET 7 -> 8
b44f29245d180 famistudio: migrate to by-name
a67591e4a88d9 famistudio: nixfmt
4831293112076 dotnet-ef: init at 9.0.0
624f1f34f93d4 caprine: disable autoUpdate functionality
22928ab873336 screenfetch: 3.9.1 -> 3.9.9
1a7827817004f bitwig-studio: fix MIDI input
b8396a883cac8 caprine: 2.60.1 -> 2.60.3
97c81d554d8bd caprine: add updateScript
330b851e0bc16 protonmail-desktop: drop darwin-support temporary (https://github.com/NixOS/nixpkgs/pull/356737)
a5afdaefb95a9 protonmail-desktop: fix update-script
f33d23dfbfc68 protonmail-desktop: 1.0.6 -> 1.5.1
92df50f4d045a nixos/tests/networking: fix flaky scripted.dhcpSimple test
296eae7ffffde lombok: 1.18.34 -> 1.18.36
e3ba3b3354fa8 python312Packages.django-leaflet: 0.30.1 -> 0.31.0
e2ba83ddf72a9 supabase-cli: 1.210.1 -> 2.0.0
a4113d92a27bd wget: fix and enable strictDeps
9f609517c8343 cargo-shuttle: 0.47.0 -> 0.49.0
b8fe6def7873a python312Packages.qtile-bonsai: init at 0.4.0
9b58cf4d57419 roslyn-ls: 4.12.0-3.24470.4 -> 4.13.0-3.24577.4
208c833f31d0d python312Packages.gradio-pdf: 0.0.17 -> 0.0.19
d181f08a12e6f hyprlandPlugins.hyprscroller: 0-unstable-2024-11-23 -> 0-unstable-2024-11-29
cfe7fefd67b48 dependency-track: 4.12.1 -> 4.12.2
3d7b61b55180d mate.mate-notification-daemon: 1.28.1 -> 1.28.3
abc9f76d7fefd xed-editor: 3.6.7 -> 3.6.9
1c4e83df052d1 telegram-desktop: 5.8.2 -> 5.9.0
534b77f8580eb nixos/victoriametrics: the prometheusConfig option isn't null by default
e77ace0bd3783 python312Packages.rpy2: 3.5.16 -> 3.5.17
578e4012fdb38 nixos/locate: update hardening from upstream
360cf296dc89a python312Packages.transaction: modernize, add nickcao to maintainers
a95c46c801805 emulationstation-de: 3.0.2 -> 3.1.0
4874736329f1f python312Packages.zope-exceptions: modernize, add nickcao to maintainers
0462ffbc3070a nexusmods-app: fix passthru tests
cc6bdfcae8246 open5gs: init at 2.7.2
0fb5a2b45c4b0 clash-rs: 0.7.1 -> 0.7.3
610fbeeb141fa hmcl: 3.5.9 -> 3.6.11
dfc303201701e pingvin-share: 1.4.0 -> 1.6.1
11e3270b19fbb wordbook: unstable-2022-11-02 -> 0.4.0
26befe6e6ec70 workflows/eval: add eval summary to commit statuses
0deecde1d4888 linuxPackages.nct6687d: 0-unstable-2024-09-02 -> 0-unstable-2024-11-05
0303357796f4a checkov: use default python (3.12)
b0d166fd16b42 tdlib: 1.8.39 -> 1.8.41
9a5c7f9e10adf python312Packages.nlpcloud: 1.1.46 -> 1.1.47
07e283f2b1e4b modules/avahi: Enable IPv6 by default
3fcf45499bf12 gnat-bootstrap: fix and enable strictDeps
b6b3c31d1aab6 opensoundmeter: 1.3 -> 1.4
3a76a34b27a92 rftg: remove
711695813d753 latencytop: remove
3834a03dee11e element-desktop: 1.11.86 -> 1.11.87
315788b4cbcba volnoti: remove
2afe5ab329981 libmx: remove
e9efed0f0c29c python312Packages.roadrecon: 1.5.0 -> 1.6.0
97da68eef5631 gtk-engine-bluecurve: remove
ad50609fbc7ae crack_attack: remove
bff1ad19f9dd6 green-pdfviewer: remove
7695b70193a46 postgresqlPackages.pg_partman: 5.1.0 -> 5.2.1
e181443fa0ef2 ytdl-sub: relax yt-dlp dependency
a0dfb5910dce0 dnf5: 5.2.7.0 -> 5.2.8.0
5d012c002dfa4 python312Packages.llama-cloud: 0.1.4 -> 0.1.6
49bb843df8118 temporal-cli: inherit version of tctl-next
c50c65c9824b6 python312Packages.transaction: 4.0 -> 5.0
a676e5bcfb9df television: 0.5.1 -> 0.5.3
ff5fcb8b18771 passepartui: 0.1.4 -> 0.1.5
e510a2b1c994a lock: 1.2.0 -> 1.3.0
e032f3a258628 diesel-cli: migrate to new darwin SDK pattern
f73975a6e3425 diesel-cli: 2.2.5 -> 2.2.6
3b413d302ee8b conda: 4.11.0 -> 24.9.2
b810247f0aa89 garnet: 1.0.39 -> 1.0.46
131ac24ca7742 conda: format
66e14e1b61c62 nodePackages.remod-cli: remove and replace with alias to pkgs.remod
b9d879b2b99e2 qtcreator: 14.0.2 -> 15.0.0
cf40653a71233 remod: init at 1.0.1
e24b70c283366 mpd: 0.23.15 -> 0.23.16
8d14b76691ffb maintainers: add xosnrdev
7bd66051d588e cargonode: init at 0.1.2
f6616c8d8fda2 rsyslog-light: 8.2408.0 -> 8.2412.0
a89cc3bf60b19 python312Packages.zope-exceptions: 5.1 -> 5.2
607d6a4ed2b0b moonraker: 0.8.0-unstable-2023-12-27 -> 0.9.3-unstable-2024-11-17
7c39317696692 linuxPackages.r8125: 9.013.02 -> 9.014.01
2e03f7f53b9e2 k9s: 0.32.6 -> 0.32.7
1e6b74a8bdc33 maintainers: add travgm
abcbf25970b0d go_1_22: 1.22.9 -> 1.22.10
ddffb7dc04d66 python312Packages.openai: 1.54.5 -> 1.56.1
c6c88693275c8 python312Packages.pynecil: 1.0.1 -> 2.0.2
d44bb5ced6aeb node-gyp: 10.2.0 -> 10.3.1
41672bef61ae6 python312Packages.lacuscore: 1.12.5 -> 1.12.6
a842f069192ef pretix: unpin ua-parser
7da1445e3d8d4 fittrackee: unpin ua-parser
6f9f58a7ada9f python312Packages.ua-parser: 0.18.0 -> 1.0.0
ae5d860ddc51c python312Packages.ua-parser-rs: init at 0.1.2
ba4d412bebf0c python312Packages.ua-parser-builtins: init at 1.0.0
ba3f758e65512 lutris: 0.5.17 -> 0.5.18
8df16a12a622b ibm-plex: add sans-sc family
082d748b2b76a mariadb-galera: 26.4.20 -> 26.4.21
6eb18c4f7087b kind: add passthru.tests and clarify updateScript
e768200e3f00c kind: format with nixfmt-rfc-style
04b0485fd09e7 kind: enable doCheck
95ffb22b2660e shotcut: 24.10.13 -> 24.11.17
ded2c6807a973 eintopf: 0.14.2 -> 0.14.3
2c1b30762bda2 keycloak: 26.0.6 -> 26.0.7
360444f92de73 haruna: 1.1.2 -> 1.2.1
7e2f76a187ee9 nixos/librenms: add netali to maintainers
4bac8c5de59aa nixos/librenms: fix links in docs
c59a8279ae973 nixos/librenms: add enableLocalBilling option
c0efae7559d54 nixos/librenms: add default php_memory_limit and use it in cronjobs
63a2350155f99 stella: 7.0 -> 7.0b
3bef6979b2592 lima: 1.0.1 -> 1.0.2
93f1d4bf602e0 java-service-wrapper: 3.5.59 -> 3.5.60
2b5db6273584e lima: add passthru.tests.version
ee19f3a3648a5 lima: format with nixfmt-rfc-style
8de3e9040f12f add mergify rules for nixpkgs
5de0ac5f38141 inform6: 6.42-r4 -> 6.42-r6
8a70db7dc9b82 mmsd-tng: 2.6.1 -> 2.6.2
4a02d96f95a35 staruml: 6.2.2 -> 6.3.0
1631e6056ef5e nixos/redmine: Add PrivateMounts to systemd unit settings
2f73a2225a8b3 hsqldb: 2.7.3 -> 2.7.4
965d2d2f18e2a shogun: disable failing tests
773ad53e66fdf debianutils: 5.20 -> 5.21
1588344e2b22e mediainfo: 24.06 -> 24.11.1
303d8c4631a55 libmediainfo: 24.06 -> 24.11
90a02412dcfc9 keepalived: 2.3.1 -> 2.3.2
280444e1a772e gwyddion: 2.66 -> 2.67
8acdab9b3579e docker-init: init at v1.30.0
2b34cf87ca90a uwsgi: 2.0.27 -> 2.0.28
72886718d423c genymotion: 3.7.1 -> 3.8.0
32bc7979db9c6 eid-mw: 5.1.19 -> 5.1.21
1b0e626b3ac38 maintainers: add lostmsu
3097041404ec5 obs-studio: fix lossless audio support
b433ca606573f doc/dotnet: bump .NET versions from 6, 7 to 8, 9
60fd285fa9278 wcslib: 8.3 -> 8.4
41a5b2b5636e3 free42: 3.1.8 -> 3.1.10
1a6c959ae8d21 tqsl: 2.7.3 -> 2.7.5
0dd903bb085ab waybar: add option for en-/disabling niri support
623446f9f00f2 python3Packages.eth-utils: 4.0.0 -> 5.1.0
316fbb8f939a1 burpsuite: 2024.10.1 -> 2024.11.1 Changelog: https://portswigger.net/burp/releases/professional-community-2024-11-1
9de368ab8743e wlink: use versionCheckHook
0f8f5cb2f2b98 wchisp: use versionCheckHook
395b04b492138 beetsPackages.copyartifacts: beets 2.1.0 compat
33e9c10983c10 beets-unstable: 2.0.0-unstable-2024-05-25 -> 2.2.0-unstable-2024-12-02
138a57266b8dd beets: 2.0.0 -> 2.2.0
bec086164a288 nixosTests.paperless: use 'database.createLocally'
cf1f7c10f4a67 nixos/paperless: add 'database.createLocally'
e494b8a7ea91d yabasic: 2.90.4 -> 2.90.5
95b9717726600 element-call: 0.6.3 -> 0.7.1
bbcd0f30526dd nixos/datadog-agent: migrate deprecated config & set bin option
2ba6271eccf51 datadog-integrations-core: 7.50.2 -> 7.56.2
5121d2de488ba datadog-agent: 7.50.3 -> 7.56.2
ede0d4bd24d53 datadog-integrations-core: 7.38.0 -> 7.50.2
44c6cc48b9a16 fsautocomplete: 0.73.2 -> 0.75.0
11a186e0263cb yadm: 3.2.2 -> 3.3.0
0277b5e57ad88 discordo: 0-unstable-2024-10-13 -> 0-unstable-2024-11-30
9e5774c4e319c python312Packages.hvplot: fix checks on darwin
ed73a9dbc4c40 shogun: modernize
6645789addf4a coursier: 2.1.14 -> 2.1.19
5a5a45bbef404 converseen: 0.12.2.3 -> 0.12.2.4
5c21bdb944e77 kubernetes-polaris: 9.5.0 -> 9.6.0
b68a2fc588763 gitoxide: 0.38.0 -> 0.39.0
6873a4d1bfc3c fn-cli: 0.6.35 -> 0.6.36
a393ecaaca2eb api-linter: 1.67.4 -> 1.67.6
62c8b9930df83 dumbpipe: 0.18.0 -> 0.20.0
849a0f105f8cd sendme: 0.18.0 -> 0.19.0
2e3963313561f kubebuilder: 4.3.0 -> 4.3.1
b7fe3f437abd1 procs: 0.14.7 -> 0.14.8
162d28f5f01b6 kube-router: 2.2.2 -> 2.3.0
969a4f9afdfef mongodb-7_0: 7.0.14 -> 7.0.15
b18ef326a0a19 mongodb-6_0: 6.0.18 -> 6.0.19
27680307b99c5 mediainfo-gui: Fix missing GSettings schemas
d334ab8ce7727 mediainfo-gui: Code format using `nixfmt-rfc-style`
8d2f58226f558 ruplacer: 0.9.0 -> 0.10.0
70a877ad9f7ed beets: nixfmt & remove dead code
4efaa7aefbdcf beets: alphabetize builtin plugins
538aacc161184 beets: mark builtin acousticbrainz plugin as deprecated
a75c56567c36a beetsPackages.extrafiles: remove broken/unmaintained plugin
ee14c24d032e9 beets: add @montchr as co-maintainer
ce1f649ca1857 mark: 11.2.0 -> 11.3.0
f00cf451419f4 jellyfin-ffmpeg: 7.0.2-5 -> 7.0.2-7
7d6602e7def39 etc-overlay: mount the metadata image read-only
a9a7bdf4d6ccd camunda-modeler: 5.28.0 -> 5.30.0
1ef196fd22b92 clipboard-jh: 0.9.1 -> 0.10.0
8f6ebec4dd22a mitra: Init at 3.9.0
9345d630c5ed1 pifpaf: 3.2.1 -> 3.2.3
8ba40fdd4fae1 lib: add defaultTo
755454e1025bf hermitcli: 0.40.0 -> 0.41.0
1145559288b88 sbt-with-scala-native: 1.10.2 -> 1.10.6
3bc43801e5fe0 jibri: 8.0-169-g1258814 -> 8.0-173-g77dc5a9
6df5a2eade5d0 nomnatong: 5.12 -> 5.13
9f0eb5a46b4ce emacsPackages.isearch-prop: 0-unstable-2022-12-30 -> 0-unstable-2024-10-13
97e4c816726c3 dxx-rebirth: 0.60.0-beta2-unstable-2024-08-11 -> 0.60.0-beta2-unstable-2024-11-16
96a8441b43bcb mailpit: 1.21.0 -> 1.21.5
00ef09a323377 pekwm: 0.3.0 -> 0.3.1
5d3907df24a15 ocamlPackages.lacaml: 11.0.10 -> 11.1.0
3114309b65106 argocd: 2.12.6 -> 2.13.1
ceb975a766fa7 fluidd: 1.30.5 -> 1.31.0
35fd31cfc5b37 zef: 0.22.4 -> 0.22.6
6933dee91752e whatsapp-for-linux: 1.6.5 -> 1.7.0
d1589acd8a876 lsb-release: rewrite with `replaceVars`, and use `@runtimeShell@`
3b23ec6d6004e istioctl: 1.23.2 -> 1.24.1
9a035ad14a35b srgn: 0.13.3 -> 0.13.4
7a33e47a7ed59 obs-studio-plugins.obs-source-record: 0.3.5 -> 0.4.1
97daa1b55daf4 ocamlPackages.eliom: 11.0.1 -> 11.1.0
c2e08444aff5b winetricks: enable darwin support
0d2b54f022cf6 rustPlatform.fetchCargoTarball: dontConfigure (by default)
378be802e8527 new-lg4ff: 0.4.0 -> 0-unstable-2024-11-25
c2048b2abfa97 taterclient-ddnet: 9.0.0 -> 9.0.1
a8146de927f1b rocksdb: 9.7.3 -> 9.7.4
b69e16a70ecfd python312Packages.gsd: 3.4.0 -> 3.4.2
09beed419d6b3 python312Packages.pyreadstat: 1.2.7 -> 1.2.8
ed34e762c14ec terraform-ls: 0.34.3 -> 0.36.0
e0754deadc120 adw-gtk3: 5.5 -> 5.6
4604b01e795b3 trunk: 0.21.1 -> 0.21.4
acc53aaa5574b pinniped: 0.33.0 -> 0.35.0
34a4ddbbee279 amarok: 3.1.0 -> 3.1.1
fdaeafade5288 python312Packages.blake3: 0.4.1 -> 1.0.0
39b2b3b5a6791 maintainers: add github attribute to amozeo
002ebede7a73f firefly-iii: fix typo
e1199370c78e9 ballerina: 2201.10.1 -> 2201.10.3
2ecf39cb209c2 moodle: 4.4.3 -> 4.4.4
9b9c3d1974815 bleep 0.0.9 -> 0.0.11
1b0f797f91c5e discordchatexporter-cli: support all unix platforms
9a994b1f5f130 alfaview: 9.17.0 -> 9.18.1
fab56ca285de3 tutanota-desktop: 250.241025.0 -> 253.241126.2
be9066a7f3c12 jprofiler: 13.0.6 -> 14.0.5
5b9283c4ef773 jprofiler: format
cdd6102925f3c jprofiler: remove catap as maintainer
fb56d1e4a7dac linuxPackages.ena: bump 2.13.0 -> 2.13.1
1441fa7fbe515 linuxPackages.ena: add updateScript
27e8e2f73c5c5 roxterm: 3.14.3 -> 3.15.3
64fa76daa13ab cozy-drive: 3.40.0 -> 3.41.0
3408cb904abf4 librespot: 0.5.0 -> 0.6.0
a0bf19172ca56 wl-mirror: 0.16.5 -> 0.17.0
f35b3e9c240d5 spring-boot-cli: 3.3.4 -> 3.4.0
f06e84eadd8fe ssm-session-manager-plugin: 1.2.677.0 -> 1.2.694.0
bdbbf3a8a1648 azpainter: 3.0.9a -> 3.0.10
4ebdf1edaafe4 python312Packages.replicate: 1.0.1 -> 1.0.4
5459214bcc079 z-lua: 1.8.19 -> 1.8.20
3f24c10cad293 snapmaker-luban: 4.10.2 -> 4.14.0
e56d88b500f50 rmapi: 0.0.27.1 -> 0.0.28
f88894d14a76b pdfstudio: format
f11e9d4e1c648 protonvpn-gui: 4.7.4 -> 4.8.0
c44e359479449 python3Packages.proton-vpn-network-manager: 0.9.7 -> 0.10.1
dddeb779ac989 proton-vpn-local-agent: 1.0.0 -> 1.2.0
0e5cc7f032991 python3Packages.proton-keyring-linux: 0.1.0 -> 0.2.0
efa60da789205 python3Packages.proton-vpn-api-core: 0.36.6 -> 0.38.2
407bd6b3446bb nixos/tests/apparmor: adopt
ceaeeb47cb395 nixos/apparmor: adopt
d2bdb08ccb202 apparmor: adopt
1825fc3612ed7 clever-tools: 3.9.0 -> 3.10.1
17dd96c4deead python312Packages.binance-connector: 3.9.0 -> 3.10.0
747ce40fe2980 cirrus-cli: 0.132.0 -> 0.133.0
79662325cb64c python312Packages.optimum: 1.23.0 -> 1.23.3
6252fe37ac71f rdkafka: 2.6.0 -> 2.6.1
bf97031d41221 mob: 5.3.1 -> 5.3.3
44636db274cb8 nginxMainline: 1.27.2 -> 1.27.3
f90d2f4a41da4 panicparse: 2.3.1 -> 2.4.0
00ba22a1c81dc lite-xl: 2.1.5 -> 2.1.6
801174a20057d bash-completion: hack around a release bug impacting BSDs
50153978426f2 cockpit: 328 -> 329.1
996f9e4f289d9 nixos/nginx: don't disable IPC
5157f42ddeecb vgm2x: 0-unstable-2024-06-18 -> 0-unstable-2024-11-17
00ee3ec75f498 tests/lomiri-mediaplayer-app: init
928dea90c68f3 nixos/lomiri: Add mediaplayer app
ff6e974816517 lomiri.lomiri-mediaplayer-app: init at 1.1.0
4bdf760ad3add python312Packages.langsmith: 0.1.137 -> 0.1.147
5f730803f3976 keka: 1.3.2 -> 1.4.6
c3e14461e9f69 cargo-bolero: 0.11.2 -> 0.12.0
8872fb10ac344 davinci-resolve: 19.0.2 -> 19.1
ff74a61763d70 sqldef: 0.17.23 -> 0.17.24
3df9613e1620d mihomo-party: add update script
d35845f8f8ba8 mihomo-party: 1.4.5 -> 1.5.12
beb6fe987b242 cloudflare-warp: format with nixfmt-rfc-style
e50228f6d9811 perlPackages.DBDMariaDB: fix strictDeps = true
8edf7a33c5cde kafkactl: 5.3.0 -> 5.4.0
b6447bb4a8027 python3Packages.proton-core: 0.3.3 -> 0.4.0
02711f4db588a c-blosc2: 2.15.1 -> 2.15.2
3c9e7c7bbfee5 cocogitto: 6.1.0 -> 6.2.0
58bc2b252dd6b asahi-nvram: 0.2.1 -> 0.2.3
e61f7d60e176e asahi-bless: 0.3.0 -> 0.4.1
a4d88020d8341 graalvm-ce: 23.0.0 -> 23.0.1
5ff378b7b8a84 mysql_jdbc: 9.0.0 -> 9.1.0
79fdb67f884df python312Packages.marimo: 0.9.14 -> 0.9.27
faf72ed584ce7 mariadb-connector-java: 3.4.1 -> 3.5.1
7f6e867bfe13e commitizen: 3.30.0 -> 4.0.0
ccd13f2bf611e moneydance: fix GTK crash
114bfcc157314 v2ray: 5.20.0 -> 5.22.0
23abd3a86673f reveal-md: 6.1.3 -> 6.1.4
8cf70f5ff0ab5 minio-warp: init at 1.0.6
df6f4e28682d2 xray: 24.9.30 -> 24.11.21
9f2c121124ba7 alda: 2.2.3 -> 2.3.1
9253eb0baac60 cilium-cli: 0.16.19 -> 0.16.20
cfb258343f5e6 alda: nixfmt
09dbeb21f149a git-pw: 2.6.0 -> 2.7.0
17f173dd44bc2 simulide: migrate to pkgs/by-name
1276771ea7f15 vulkan-cts: 1.3.9.0 -> 1.3.10.0
34ae6ed370f62 simulide: don't use libsForQt5.callPackage
dd90a1d99b288 mlflow-server: 2.17.2 -> 2.18.0
f1f9a54031dbc cups-filters: 1.28.17 -> 2.0.1
95c563d5121d3 sickgear: 3.32.10 -> 3.32.11
c4a7f5477b2ba python312Packages.art: 6.3 -> 6.4
d1946291d1bd0 tartube-yt-dlp: 2.5.040 -> 2.5.059
b4bb0db86bf97 kops_1_30: 1.30.1 -> 1.30.2
f9b403d5d3503 mirrord: init at 3.125.0
74cb0ae183e48 dracula-theme: 4.0.0-unstable-2024-10-03 -> 4.0.0-unstable-2024-11-26
4b53e94e9cf1d wikiman: init at 2.13.2
f9ba1e0f76a88 funzzy: 1.2.0 -> 1.5.0
f387cf1f21845 twilio-cli: 5.22.3 -> 5.22.6
5c182f857e5f8 nickel: 1.8.1 -> 1.9.0
c826dbd65f195 python312Packages.tinydb: 4.8.0 -> 4.8.2
57b8861c473e6 pachyderm: 2.11.4 -> 2.11.5
5316344dfd0b5 questdb: 8.1.2 -> 8.2.0
cc4a61e075442 ibus-engines.typing-booster-unwrapped: 2.25.17 -> 2.26.11
617e1366d53f7 snappymail: 2.38.1 -> 2.38.2
036b0bb41dd6e bngblaster: 0.9.8 -> 0.9.12
900bd0d8e6203 nixos/buffyboard: init
6f32fcb8778d4 qdrant-web-ui: 0.1.31 -> 0.1.33
8d30d5b339bb2 weaviate: 1.26.6 -> 1.27.5
01a0ebafcae43 zimfw: 1.15.0 -> 1.16.0
09a7678c51686 quarto: 1.6.33 -> 1.6.37
1dce7c5b2fda1 kuma: 2.8.3 -> 2.9.1
d75d17e1e84f6 nixos/cage: add package option
1ff7a913595a0 amdvlk: 2024.Q3.3 -> 2024.Q4.1
31153e09fce1a moneydance: apply nixfmt
39ecccc962831 pioasm: 2.0.0 -> 2.1.0
798d1b5285aac ocamlPackages.gsl: 1.25.0 -> 1.25.1
2d59c247599f7 fend: 1.5.3 -> 1.5.5
97dd1a61b7794 proxmox-auto-install-assistant: switch to versionCheckHook
51759e8046caa proxmox-auto-install-assistant: 8.2.6 -> 8.3.3
40f32aaf16809 vscode-js-debug: 1.94.0 -> 1.95.3
b5442735ff0f7 buffybox: init at 3.2.0-unstable-2024-11-10
2cded1ab8dbbb polarity: add nix-update updatescript
6a2805234bbff apache-answer: init at 1.4.1
216c6f28d9c89 surrealist: 2.1.6 -> 3.0.8
3f8bc3e45a28e cubiomes-viewer: 4.1.0 -> 4.1.2
ca4419dfde56e zfs-replicate: 3.2.13 -> 4.0.0
88f51e4196afd jackett: 0.22.893 -> 0.22.998
72b1eeadda7ba jicofo: 1.0-1090 -> 1.0-1104
c2e4e74e95a68 sesh: 2.5.0 -> 2.6.0
093558f82bdeb quarto: use pandoc 3.5
5c913007c6234 pandoc: add version 3.5
d8b5f031dc448 nixos/crashdump: remove redundant kernel patch
fc3871aa8ad6d linux/common-config: enable support for crashkernel dumps
c2a95086c5237 micronaut: 4.6.3 -> 4.7.1
cfcccc73e6b56 s2geometry: enable on unix
bd4e8d2878d69 gpxlab: migrate to by-name
dc5f9d7ea9a8b gpxlab: add symlink to binary on darwin
b394dc14e86ef railway-wallet: 5.17.10 -> 5.19.4
7353ca42e5be1 heroku: 9.3.0 -> 9.5.0
8808a76d0c4be flannel: 0.25.7 -> 0.26.1
4b848193dadda ansel: 0-unstable-2024-09-29 -> 0-unstable-2024-10-28
df13ffdfb0df5 papermc: 1.21.1-119 -> 1.21.3-53
236e31deb941b acme-sh: 3.0.9 -> 3.1.0
c7fe0ba1a142d qemu: fix strictDeps
650928dc6759e tree-sitter: update webui fix-paths.patch
dd0977818d69d graalvmCEPackages.truffleruby: 24.0.1 -> 24.1.1
1493059fb9421 graalvmCEPackages.graalpy: 24.0.1 -> 24.1.1
e51543cab8745 graalvmCEPackages.graalnodejs: 24.0.1 -> 24.1.1
68e8a6ef35c05 marktext: build from source
9e67608a3ee0b marktext: nixfmt
045921d4b05ff lilypond-unstable: 2.25.20 -> 2.25.21
37b61d4c47346 istatmenus: init at 7.02.10
58a8067afbb0a rustdesk-server: 1.1.11-1 -> 1.1.12
df0f5907470cd rqlite: 8.31.2 -> 8.34.1
ae8aa6f04752a kubeone: 1.8.3 -> 1.9.0
42efdd11c6d55 google-java-format: 1.24.0 -> 1.25.0
a997d6d81cec1 yubikey-touch-detector: 1.11.0 -> 1.12.0
2c034c521677c haskellPackages.pandoc-cli_3_5: fix build
53b61e7a0ea65 python312Packages.datalad: refactor
dc5239bd1caf9 Update shntool to patch bugs
b1dc24918a06d maintainers: add ShawnToubeau
453c0fbb1e287 vue-language-server: 2.1.6 -> 2.1.10
e9bc776c6b774 paperjam: init at 1.2.1
88beeeb88dedb ocamlPackages.asai: 0.3.0 -> 0.3.1
18ed1c4e97207 kopia: 0.17.0 -> 0.18.2
6b9033af806c2 ocamlPackages.happy-eyeballs: 1.1.0 -> 1.2.2
83250cf4178be maintainers: add FirelightFlagboy
b3e39e3ee9b2e hubstaff: 1.6.26-95441346 -> 1.6.28-fafb0aba
0593c1fab44ad git-cliff: 2.6.1 -> 2.7.0
063a83a71b091 rabbitmq-c: 0.14.0 -> 0.15.0
095b8a3af886f reuse: 4.0.3 -> 5.0.2
9f6cfce9c5a2a crowdsec: 1.6.3 -> 1.6.4
13552fd8228fd fioctl: 0.42 -> 0.43
8de980f74866b atlantis: 0.28.5 -> 0.30.0
ea505ba4cac56 kubernetes-helmPlugins.helm-unittest: 0.5.2 -> 0.6.3
2e73f304b59a4 p2pool: 4.1.1 -> 4.2
b2659e7ad316b termius: 9.7.2 -> 9.8.5
892b1f3a1c74d kittycad-kcl-lsp: init at 0.1.61
386bc09b61cce maintainers: add jljox
eea7e3a90dc96 rygel: make gtk support optional
415b0ea85b2cb python312Packages.datalad: 1.1.3 -> 1.1.4
b7ea84f90078a nixos-options: don't use references for string_views
cf11719258788 nixos-option: disable modernize-use-trailing-return-type
7a8407e477f58 nixos-option: fix potential memory leak in mapOptions
6fe4fb2b95a81 nixos-option: enable cppcoreguidelines lints
e7367a6eabb55 nixos-option: enable misc lints
1e59fb41f0a66 nixos-option: enable more lints
e5705ba07b6bd nixos-option: enable readability lint
9c4e940564af9 nixos-option: enable modernize-* checks in clang-tidy
95d71aedd5a60 initool: 0.18.0 -> 1.0.0
38b076534b831 gifski: remove meta `with lib` use
0cf736ebdd174 gifski: move to by-name
baf8c5d3daaa2 gifski: format using nixfmt
60065ac2e06cd gifski: use `useFetchCargoVendor`
cb9f9a1e5a51a fetchgit{,hub}: add tag argument
ee355521d0d0a video2midi: 0.4.8 -> 0.4.9
34049645be1de airshipper: 0.14.0 -> 0.15.0
4fc640279dd2c dolt: 1.43.1 -> 1.43.15
d91b4a9c047cb jitsi-meet-prosody: 1.0.8091 -> 1.0.8242
2926cde0ff737 tabby: 0.19.0 -> 0.20.0
06d460dbb27eb maintainers: add gurjaka
f464a3ab33f28 i3-rounded: unstable-2021-10-03 -> 4.21.1
b8fa6e26eb7b4 yourkit-java: 2024.9-b158 -> 2024.9-b159
1f3975fc27282 attic-client: 0-unstable-2024-10-06 -> 0-unstable-2024-11-10
7a87303563fa0 pulsarctl: 2.11.1.3 -> 4.0.0.4
3cb3f1a51f97a hydrus: 595 -> 598
9f1665e1f823d jbang: 0.119.0 -> 0.120.4
ed0c00f8abc14 wsysmon: remove procps dep and dynamically link spdlog
66f4003f0ff82 sftpgo: 2.6.2 -> 2.6.3
6cf58c53e3ca0 keymapper: 4.8.2 -> 4.9.0
5bdf0a4831215 healthchecks: 3.6 -> 3.7
aef4e7d0bdad3 glooctl: 1.17.14 -> 1.17.16
41f5151102c62 maintainers: add BastianAsmussen
82803318055e6 renode-unstable: 1.15.3+20241004git4b8a8f170 -> 1.15.3+20241112git6e850cb52
934cf4cdea4c8 rpPPPoE: 3.12 -> 4.0 and build kernel mode plugin
4e84219665352 gcalcli: 4.4.0 -> 4.5.1
33586ab6d6875 boogie: 3.2.5 -> 3.4.2
1cdc18fbbfb05 jitsi-videobridge: 2.3-160-g97a1f15b -> 2.3-174-gd011ddf7
ccfbd723b3678 passt: 2024_09_06.6b38f07 -> 2024_10_30.ee7d0b6
fe3ce419eb0b6 dprint: switch to the new darwin sdk pattern
4155ccc122bb6 dprint: 0.47.2 -> 0.47.5
ef9f08ed35e96 dprint: add updateScript
d76335d634306 dprint: add passthru.tests.version
e4e84b2b36b33 dprint: format with nixfmt-rfc-style
c3e48526e0a53 nixos-option: enable performance lint
01580b19ae9ae nixos-option: enable bugprone lints
2cfcb6f44242c nixos-option: don't throw errors in main
e8d76d62a2871 nixos-option: explicitly cast to int from size_t
553461adc754f nixos-option: use c++20 starts_with
226981490b9eb nixos-option: clean up includes based on clang-tidy suggestions
7e9e33e79c700 nixos-option: add devShell
00c3a3defe134 nixos-option: add clang-tidy
4ec848d3650e2 komika-fonts: init at 0-unstable-2024-08-12
e351a0b8409da maintainers: add pancaek
69a605dedd31d hyperrogue: 13.0r -> 13.0v
0c7055e9a7dae mystmd: 1.3.8 -> 1.3.17
c567efd682d38 pwsafe: 1.18.0 -> 1.20.0
f0cc69f4ab14b kind: 0.2.4 -> 0.2.5
07ccfe68437c7 tree-sitter-grammars.tree-sitter-twig: init
fe7142ef013ae aws-shell: init at 0.2.2
f28124f58a6db vulkan-hdr-layer-kwin6: init at 0-unstable-2024-10-19
899a7b2472bc3 maintainers: add d4rk
0f3f545623648 maintainers: add nateeag
1c327386b4934 maintainers: add DictXiong
a27e48e1b2450 treewide: remove `= __splicedPackages`
41960fcdacbaf splice.nix: make `pkgs` `splicedPackages` when required
872d4bf33ed0c vkquake: 1.31.2 -> 1.31.3
c659022ecb860 schemacrawler: 16.22.2 -> 16.22.3
7578f3833bf6f plasma-panel-spacer-extended: init at 1.9.0
034aab107d194 criu: 3.19 -> 4.0
016e5f240f44e piper: refactor
77ee7fc30af0f piper: format with nixfmt
a6229420a3d03 piper: 0.7 -> 0.8
3442068f54253 libratbag: refactor
71b8c39ca813c libratbag: format with nixfmt
0c38fa2802129 libratbag: 0.17 -> 0.18
3a7bef85cad99 sbctl: don't use pname in src
fc30e169ac236 sbctl: nixfmt
9cc2c5f0fd022 sbctl: don't generate completions when cross compiling
49fec30e86719 sbctl: 0.14 -> 0.16
563987104e9ce linux config: enable cp15 barrier emulation on aarch64
ec1db0b739212 turbovnc: 3.1.2 -> 3.1.3
d231c9ea3a2f7 ocamlPackages.cairo2: 0.6.4 -> 0.6.5
2f9c81ffb1851 ocamlPackages.sel: 0.4.0 -> 0.5.0
b51666b2cc4e3 gnomeExtensions.pano: 22 -> v23-alpha3
1ed59a4eb8a0d lix: only use LTO with GCC
0512de251218d nixos/galene: add turnAddress option and fix httpAddress
3b48a63ac5d4b polybar: remove references to cc before makeWrapper
dbfb1a7338c1a python3Packages.django: fix build on 32 bit platforms
d84584efcec27 filesender: 2.49 -> 2.50
048d8cceeec8d nixos/qemu-vm: minor readability improvements
2610a20422b56 joypixels: 8.0.0 -> 9.0.0
9b2793b6ef23e python312Packages.pytest-variables: init at 3.1.0
0b09ff1954bbe python312Packages.vbuild: init at 0.8.2
88b18841422dc nixos/akkoma: Make imports explicit
4f2b5f3788566 auto-editor: init at 25.3.0
87df940a6a1eb raspberrypifw: 1.20240926 -> 1.20241008
39735e83b2a6c rutorrent: 4.2.10 -> 4.3.8
708a493c13979 python3: proper syntax for Windows patches
2367be910aabb python3Packages.dirsearch: init at 0.4.3
9477947a1a799 openseeface: init at 1.20.4-unstable-2024-09-21
ad7b2f3438963 lib/types: make pattern of strMatching accessible
176d86712b014 beedii: init at 1.0.0
4fe3724ce4014 joypixels: Reflect redistributability in the license
65664d6ba2909 nixos/gotenberg: fix service config for chromium
9ce0e1dcaf106 eddy: 1.2.1 -> 3.6
9264b0fd2a3c5 ibus: fix cross compilation
765c9bf44e30f nixos/qgroundcontrol: Add cfg.package option
380350455a9e8 qgroundcontrol: Disable bad message
4d33914586370 rocmPackages_5.rocm-docs-core: 0.26.0 -> 1.8.2
92121e43ea9b5 nixos/prometheus-exporters: add assertion for restic repository options to make them mutually exclusive
ac80f2cc333c8 nixos/prometheus-restic-exporter: add repositoryFile option
2a8f33535502c nixos/postfix: add missing mkDefault for smtpd tls config
e447004694c6f cni-plugin-flannel: 1.2.0 -> 1.5.1-flannel3
4147f4a424d92 osmscout-server: 3.0.0 -> 3.1.0
00a43d7d03a4d doc/languages-frameworks/python: update references to python 3.12
3e2e5daab4994 doc/languages-frameworks/python: Reword section to make commit rules a bit clearer
11c4e6b9dfe91 inputstream-adaptive: only create symlink for libcdm_aarch64_loader.so on aarch64
7acf6b2e9bfbe inputstream-adaptive: remove symlink for libssd_wv.so
f40bcf1bd28cf inputstream-adaptive: add symlink to libcdm_aarch64_loader.so
6504eee8e06ea ecc: 1.0.12 -> 1.0.27
3b9e993adb4f3 maintainers: add nezia
8ba961591c859 build(deps): bump korthout/backport-action from 3.0.2 to 3.1.0
1fb18e1e5fe29 promptfoo: 0.57.1 -> 0.79.0
a9b277d734269 python3Packages.pycolorecho: init at 0.1.1
16782bd5568bf v2raya: add cliPackage option
77f4097425aed unbound: support dynlib module
b5d50eae88f4f quakespasm: 0.96.0 -> 0.96.3
259db30f0bac3 nixos/lib/qemu-common: fix cross to x86_64
831f9b6052383 languagetool: fix description on allowOrigin option
4ff2f4a1f28c9 qjackctl: 0.9.13 -> 0.9.91
1d261ca49aa0e hunspellDicts.et_EE: init at 20030606
bd87a38b86f88 nixos/lemmy: fix nginx backend to proxy needed headers
39eaf6e74658f nixos/plymouth: add support for logo in catppuccin (two-step) theme
c151a5bd4f78e firefox_decrypt: 1.1.0 -> 1.1.1
83280493512a5 mlton: enable aarch64-darwin
cb8d3762a6b0f mlton: bootstrap with 20210117 version
8f582b0ebb792 nsncd: 3 seconds is way too low for a default timeout
f7d21be1d3aae nixos/wrapper: pass trusted argv[0] to the privileged executable
e9ab2de5ed0d1 nixos/vault-agent: make template value optional
f43fb79c08b86 [nbstripout] Don't propagate ipython
fc4e95e2e0966 nixos/v2ray: change the type of `config` field

git-subtree-dir: third_party/nixpkgs
git-subtree-split: 5d67ea6b4b63378b9c13be21e2ec9d1afc921713
2024-12-13 20:54:23 +00:00

70 lines
1.9 KiB
Nix

{
lib,
stdenv,
fetchFromGitHub,
cmake,
perl,
python3,
tbb,
zlib,
runCommand,
bowtie2,
}:
stdenv.mkDerivation (finalAttrs: {
pname = "bowtie2";
version = "2.5.4";
src = fetchFromGitHub {
owner = "BenLangmead";
repo = "bowtie2";
rev = "refs/tags/v${finalAttrs.version}";
fetchSubmodules = true;
hash = "sha256-ZbmVOItfAgKdsMrvQIXgKiPtoQJZYfGblCGDoNPjvTU=";
};
# because of this flag, gcc on aarch64 cannot find the Threads
# Could NOT find Threads (missing: Threads_FOUND)
# TODO: check with other distros and report upstream
postPatch = ''
substituteInPlace CMakeLists.txt \
--replace "-m64" ""
'';
nativeBuildInputs = [ cmake ];
buildInputs = [
tbb
zlib
python3
perl
];
cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) [
"-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"
];
# ctest fails because of missing dependencies between tests
doCheck = false;
passthru.tests = {
ctest = runCommand "${finalAttrs.pname}-test" { } ''
mkdir $out
${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
${bowtie2}/bin/bowtie2-inspect-s $out/small
${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
${bowtie2}/bin/bowtie2-inspect-l $out/large
'';
};
meta = with lib; {
description = "Ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
license = licenses.gpl3Plus;
homepage = "http://bowtie-bio.sf.net/bowtie2";
changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${lib.removePrefix "refs/tags/" finalAttrs.src.rev}";
maintainers = with maintainers; [ rybern ];
platforms = platforms.all;
mainProgram = "bowtie2";
};
})